Morpholino
MO1-slc8a1a
- ID
- ZDB-MRPHLNO-051228-4
- Name
- MO1-slc8a1a
- Previous Names
- None
- Target
- Sequence
-
5' - TGTTCCCAGTGAGGTATTTTGTTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc8a1a
No data available
Phenotype
Phenotype resulting from MO1-slc8a1a
| Phenotype | Fish | Figures |
|---|---|---|
| head decreased size, abnormal | WT + MO1-slc8a1a |
Fig. 1 
from Ebert et al., 2005 |
| pericardium edematous, abnormal | WT + MO1-slc8a1a |
Fig. 1
from Ebert et al., 2005 |
Phenotype of all Fish created by or utilizing MO1-slc8a1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| head decreased size, abnormal | WT + MO1-slc8a1a | standard conditions |
Fig. 1
from Ebert et al., 2005 |
| pericardium edematous, abnormal | WT + MO1-slc8a1a | standard conditions |
Fig. 1
from Ebert et al., 2005 |
Citations
- Musso, G., Tasan, M., Mosimann, C., Beaver, J.E., Plovie, E., Carr, L.A., Chua, H.N., Dunham, J., Zuberi, K., Rodriguez, H., Morris, Q., Zon, L., Roth, F.P., and MacRae, C.A. (2014) Novel cardiovascular gene functions revealed via systematic phenotype prediction in zebrafish. Development (Cambridge, England). 141(1):224-235
- Ebert, A.M., Hume, G.L., Warren, K.S., Cook, N.P., Burns, C.G., Mohideen, M.A., Siegal, G., Yelon, D., Fishman, M.C., and Garrity, D.M. (2005) Calcium extrusion is critical for cardiac morphogenesis and rhythm in embryonic zebrafish hearts. Proceedings of the National Academy of Sciences of the United States of America. 102(49):17705-17710
1 - 2 of 2
Show