Morpholino

MO1-fgf19

ID

ZDB-MRPHLNO-051220-8

Name

MO1-fgf19

Previous Names

fgf19 MO (1)

Target

fgf19 (1)

Sequence

5' - CAGTGACAAAGAGTAAGAGGAGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino targets the translation start site of fgf19.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fgf19

Expressed Gene	Anatomy	Figures
b3gnt5a	(not) solid lens vesicle	Fig. 4 from Nakayama et al., 2008
crybb1	solid lens vesicle	Fig. 4 from Nakayama et al., 2008
dlx2a	diencephalon telencephalon (not) ventral telencephalon (not) ventral thalamus	Fig. 5 , Fig. 8 from Miyake et al., 2005
dmbx1a	midbrain optic tectum	Fig. 6 from Miyake et al., 2005
efna3b	(not) presumptive neural retina	Fig. 6 from Nakayama et al., 2008
efna5a	presumptive neural retina	Fig. 6 from Nakayama et al., 2008
emx1	telencephalon	Fig. 5 , Fig. 8 from Miyake et al., 2005
en2a	cerebellum midbrain	Fig. 6 from Miyake et al., 2005
epha4b	presumptive neural retina	Fig. 6 from Nakayama et al., 2008
fgf3	midbrain hindbrain boundary optic stalk presumptive neural retina	Fig. 9 from Nakayama et al., 2008 Fig. 7 from Miyake et al., 2005
fgf8a	midbrain hindbrain boundary presumptive neural retina	Fig. 9 from Nakayama et al., 2008 Fig. 7 from Miyake et al., 2005
fgf16	(not) forebrain (not) midbrain	Fig. 9 from Miyake et al., 2014
foxg1a	presumptive neural retina	Fig. 6 from Nakayama et al., 2008
gad1b	forebrain	Fig. 8 from Miyake et al., 2005
gad2	forebrain	text only from Miyake et al., 2005
isl1a	epiphysis retina telencephalon ventral thalamus	Fig. 5 from Nakayama et al., 2008 Fig. 5 from Miyake et al., 2005
mafa	(not) solid lens vesicle	Fig. 4 from Nakayama et al., 2008
mafba	solid lens vesicle	Fig. 4 from Nakayama et al., 2008
neurod1	retina	Fig. 5 from Nakayama et al., 2008
olig2	telencephalon thalamus	Fig. 8 from Miyake et al., 2005
otx2b	midbrain thalamus	Fig. 6 from Miyake et al., 2005
pax2a	optic stalk	Fig. 6 from Nakayama et al., 2008
pax6a	optic vesicle telencephalon thalamus	Fig. 6 from Nakayama et al., 2008 Fig. 5 from Miyake et al., 2005
prox1a	solid lens vesicle	Fig. 4 from Nakayama et al., 2008
tbr1b	telencephalon	Fig. 5 from Miyake et al., 2005
tbx5a	presumptive neural retina	Fig. 6 from Nakayama et al., 2008
vax2	presumptive neural retina	Fig. 6 from Nakayama et al., 2008

Phenotype

Phenotype resulting from MO1-fgf19

Phenotype	Fish	Figures
forebrain development disrupted, abnormal	WT + MO1-fgf19	Fig. 9 from Miyake et al., 2014
lens apoptotic, abnormal	WT + MO1-fgf19	Fig. 3 from Nakayama et al., 2008
lens decreased size, abnormal	WT + MO1-fgf19	Fig. 1 from Nakayama et al., 2008
midbrain development disrupted, abnormal	WT + MO1-fgf19	Fig. 9 from Miyake et al., 2014
optic fissure closure incomplete, abnormal	WT + MO1-fgf19	Fig. 1 from Nakayama et al., 2008
retina apoptotic, abnormal	WT + MO1-fgf19	Fig. 3 from Nakayama et al., 2008
retina decreased size, abnormal	WT + MO1-fgf19	Fig. 1 from Nakayama et al., 2008
retina distended, abnormal	WT + MO1-fgf19	Fig. 1 from Nakayama et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal	WT + MO1-fgf19	Fig. 8 from Nakayama et al., 2008

Phenotype of all Fish created by or utilizing MO1-fgf19

Phenotype	Fish	Conditions	Figures
optic fissure closure incomplete, abnormal	WT + MO1-fgf19	standard conditions	Fig. 1 from Nakayama et al., 2008
midbrain development disrupted, abnormal	WT + MO1-fgf19	standard conditions	Fig. 9 from Miyake et al., 2014
retina apoptotic, abnormal	WT + MO1-fgf19	standard conditions	Fig. 3 from Nakayama et al., 2008
lens apoptotic, abnormal	WT + MO1-fgf19	standard conditions	Fig. 3 from Nakayama et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal	WT + MO1-fgf19	standard conditions	Fig. 8 from Nakayama et al., 2008
retina decreased size, abnormal	WT + MO1-fgf19	standard conditions	Fig. 1 from Nakayama et al., 2008
retina distended, abnormal	WT + MO1-fgf19	standard conditions	Fig. 1 from Nakayama et al., 2008
lens decreased size, abnormal	WT + MO1-fgf19	standard conditions	Fig. 1 from Nakayama et al., 2008
forebrain development disrupted, abnormal	WT + MO1-fgf19	standard conditions	Fig. 9 from Miyake et al., 2014

Citations