Morpholino

MO1-fgf19

ID
ZDB-MRPHLNO-051220-8
Name
MO1-fgf19
Previous Names
  • fgf19 MO (1)
Target
Sequence
5' - CAGTGACAAAGAGTAAGAGGAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino targets the translation start site of fgf19.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 7
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf19
Expressed Gene Anatomy Figures
b3gnt5a Fig. 4 with image from Nakayama et al., 2008
crybb1 Fig. 4 with image from Nakayama et al., 2008
dlx2a Fig. 5 with image,  Fig. 8 with image from Miyake et al., 2005
dmbx1a Fig. 6 with image from Miyake et al., 2005
efna3b Fig. 6 with image from Nakayama et al., 2008
efna5a Fig. 6 with image from Nakayama et al., 2008
emx1 Fig. 5 with image,  Fig. 8 with image from Miyake et al., 2005
en2a Fig. 6 with image from Miyake et al., 2005
epha4b Fig. 6 with image from Nakayama et al., 2008
fgf3 Fig. 9 with image from Nakayama et al., 2008
Fig. 7 with image from Miyake et al., 2005
fgf8a Fig. 9 with image from Nakayama et al., 2008
Fig. 7 with image from Miyake et al., 2005
fgf16 Fig. 9 with image from Miyake et al., 2014
foxg1a Fig. 6 with image from Nakayama et al., 2008
gad1b Fig. 8 with image from Miyake et al., 2005
gad2 text only from Miyake et al., 2005
isl1a Fig. 5 with image from Nakayama et al., 2008
Fig. 5 with image from Miyake et al., 2005
mafa Fig. 4 with image from Nakayama et al., 2008
mafba Fig. 4 with image from Nakayama et al., 2008
neurod1 Fig. 5 with image from Nakayama et al., 2008
olig2 Fig. 8 with image from Miyake et al., 2005
otx2b Fig. 6 with image from Miyake et al., 2005
pax2a Fig. 6 with image from Nakayama et al., 2008
pax6a Fig. 6 with image from Nakayama et al., 2008
Fig. 5 with image from Miyake et al., 2005
prox1a Fig. 4 with image from Nakayama et al., 2008
tbr1b Fig. 5 with image from Miyake et al., 2005
tbx5a Fig. 6 with image from Nakayama et al., 2008
vax2 Fig. 6 with image from Nakayama et al., 2008
Phenotype
Phenotype resulting from MO1-fgf19
Phenotype Fish Figures
forebrain development disrupted, abnormal WT + MO1-fgf19 Fig. 9 with image from Miyake et al., 2014
lens apoptotic, abnormal WT + MO1-fgf19 Fig. 3 with image from Nakayama et al., 2008
lens decreased size, abnormal WT + MO1-fgf19 Fig. 1 with image from Nakayama et al., 2008
midbrain development disrupted, abnormal WT + MO1-fgf19 Fig. 9 with image from Miyake et al., 2014
optic fissure closure incomplete, abnormal WT + MO1-fgf19 Fig. 1 with image from Nakayama et al., 2008
retina apoptotic, abnormal WT + MO1-fgf19 Fig. 3 with image from Nakayama et al., 2008
retina decreased size, abnormal WT + MO1-fgf19 Fig. 1 with image from Nakayama et al., 2008
retina distended, abnormal WT + MO1-fgf19 Fig. 1 with image from Nakayama et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal WT + MO1-fgf19 Fig. 8 with image from Nakayama et al., 2008
Phenotype of all Fish created by or utilizing MO1-fgf19
Phenotype Fish Conditions Figures
optic fissure closure incomplete, abnormal WT + MO1-fgf19 standard conditions Fig. 1 with image from Nakayama et al., 2008
midbrain development disrupted, abnormal WT + MO1-fgf19 standard conditions Fig. 9 with image from Miyake et al., 2014
retina apoptotic, abnormal WT + MO1-fgf19 standard conditions Fig. 3 with image from Nakayama et al., 2008
lens apoptotic, abnormal WT + MO1-fgf19 standard conditions Fig. 3 with image from Nakayama et al., 2008
retinal ganglion cell axon guidance disrupted, abnormal WT + MO1-fgf19 standard conditions Fig. 8 with image from Nakayama et al., 2008
retina decreased size, abnormal WT + MO1-fgf19 standard conditions Fig. 1 with image from Nakayama et al., 2008
retina distended, abnormal WT + MO1-fgf19 standard conditions Fig. 1 with image from Nakayama et al., 2008
lens decreased size, abnormal WT + MO1-fgf19 standard conditions Fig. 1 with image from Nakayama et al., 2008
forebrain development disrupted, abnormal WT + MO1-fgf19 standard conditions Fig. 9 with image from Miyake et al., 2014
Citations
TSV
1 - 5 of 5
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.