Morpholino

MO2-onecut1

ID

ZDB-MRPHLNO-051215-2

Name

MO2-onecut1

Previous Names

Target

Sequence

5' - TGTCTGACTTTTGCATATCGACATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-onecut1

No data available

Phenotype

Phenotype resulting from MO2-onecut1

Phenotype	Fish	Figures
bile ductule aplastic, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
bile ductule decreased amount, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
bile ductule dilated, abnormal	WT + MO2-onecut1	Fig. 7 from Matthews et al., 2004
bile ductule lumenized, abnormal	WT + MO2-onecut1	Fig. 7 from Matthews et al., 2004
bile ductule obstructed, abnormal	WT + MO2-onecut1	Fig. 7 from Matthews et al., 2004
eye decreased size, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
head increased size, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct decreased thickness, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct dilated, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct distributed, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct length, abnormal	WT + MO2-onecut1	Fig. 6 from Matthews et al., 2004
lipid metabolic process process quality, abnormal	WT + MO2-onecut1	Fig. 7 from Matthews et al., 2004
liver and biliary system decreased functionality, abnormal	WT + MO2-onecut1	Fig. 7 from Matthews et al., 2004

Phenotype of all Fish created by or utilizing MO2-onecut1

Phenotype	Fish	Conditions	Figures
liver and biliary system decreased functionality, abnormal	WT + MO2-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
bile ductule aplastic, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
lipid metabolic process process quality, abnormal	WT + MO2-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
bile ductule decreased amount, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
eye decreased size, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
head increased size, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule obstructed, abnormal	WT + MO2-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
intrahepatic bile duct distributed, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct dilated, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule lumenized, abnormal	WT + MO2-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
bile ductule dilated, abnormal	WT + MO2-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
intrahepatic bile duct length, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct decreased thickness, abnormal	WT + MO2-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004

Citations