Morpholino

MO1-onecut1

ID

ZDB-MRPHLNO-051214-2

Name

MO1-onecut1

Previous Names

hnf-6 IE2 (1)

Target

onecut1 (1)

Sequence

5' - TTCAGCGTGCAAACGAAAGGAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-onecut1

Expressed Gene	Anatomy	Figures
cp	liver	Fig. 7 from Matthews et al., 2005
vps33b	liver	Fig. 7 from Matthews et al., 2005

Phenotype

Phenotype resulting from MO1-onecut1

Phenotype	Fish	Figures
bile ductule aplastic, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
bile ductule decreased amount, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
bile ductule dilated, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2004
bile ductule lumenized, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2004
bile ductule obstructed, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2004
eye decreased size, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
head increased size, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct decreased thickness, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct dilated, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct distributed, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct length, abnormal	WT + MO1-onecut1	Fig. 6 from Matthews et al., 2004
lipid metabolic process process quality, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2004
liver and biliary system decreased functionality, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2004
liver and biliary system morphology, abnormal	WT + MO1-onecut1	Fig. 7 from Matthews et al., 2005

Phenotype of all Fish created by or utilizing MO1-onecut1

Phenotype	Fish	Conditions	Figures
bile ductule lumenized, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
lipid metabolic process process quality, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
intrahepatic bile duct length, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule dilated, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
intrahepatic bile duct distributed, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct decreased thickness, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule obstructed, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
eye decreased size, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
intrahepatic bile duct dilated, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule decreased amount, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
liver and biliary system decreased functionality, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2004
head increased size, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
bile ductule aplastic, abnormal	WT + MO1-onecut1	standard conditions	Fig. 6 from Matthews et al., 2004
liver and biliary system morphology, abnormal	WT + MO1-onecut1	standard conditions	Fig. 7 from Matthews et al., 2005
intrahepatic bile duct cell decreased amount, abnormal	WT + MO1-onecut1 + MO4-prickle1a	standard conditions	Fig. 7 from Cui et al., 2011
liver decreased functionality, abnormal	WT + MO1-onecut1 + MO4-prickle1a	standard conditions	Fig. 7 from Cui et al., 2011
intrahepatic bile duct development disrupted, abnormal	WT + MO1-onecut1 + MO4-prickle1a	standard conditions	Fig. 7 from Cui et al., 2011

Citations