Morpholino
MO3-sema3d
- ID
- ZDB-MRPHLNO-051128-4
- Name
- MO3-sema3d
- Previous Names
- Target
- Sequence
-
5' - CACATTCAGTCTGCAGCAAGAGAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino is a splice blocker at the 4th intron / 5th exon boundary of the gene sema3d.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sema3d
Expressed Gene | Anatomy | Figures |
---|---|---|
ccna2 |
Fig. 4
from Berndt et al., 2006 |
|
ccnd1 |
Fig. 4 ,
Fig. S2
from Berndt et al., 2006 |
|
cdkn1ca |
Fig. 4
from Berndt et al., 2006 |
|
crestin |
Fig. 2
from Berndt et al., 2006 Fig. 3 from Sato et al., 2006 |
|
dlx2a |
Fig. 2
from Berndt et al., 2006 |
|
rag1 |
|
Fig. 3
from Sato et al., 2006 |
Phenotype
Phenotype resulting from MO3-sema3d
Phenotype | Fish | Figures |
---|---|---|
enteric neuron decreased amount, abnormal | WT + MO3-sema3d |
Fig. 3
from Jiang et al., 2015 |
gut innervation disrupted, abnormal | WT + MO3-sema3d |
Fig. 3
from Jiang et al., 2015 |
Phenotype of all Fish created by or utilizing MO3-sema3d
Citations