Morpholino
MO4-cxcl12a
- ID
- ZDB-MRPHLNO-051028-3
- Name
- MO4-cxcl12a
- Previous Names
- Target
- Sequence
-
5' - TTGAGATCCATGTTTGCAGTGTGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-cxcl12a
No data available
Phenotype
Phenotype resulting from MO4-cxcl12a
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO4-cxcl12a
1 - 5 of 36 Show all
Citations
- Westerich, K.J., Reinecke, S., Emich, J., Wyrwoll, M.J., Stallmeyer, B., Meyer, M., Oud, M.S., Fietz, D., Pilatz, A., Kliesch, S., Reichman-Fried, M., Tarbashevich, K., Limon, T., Stehling, M., Friedrich, C., Tüttelmann, F., Raz, E. (2023) Linking human Dead end 1 (DND1) variants to male infertility employing zebrafish embryos. Human reproduction (Oxford, England). 38(4):655-670
- Truszkowski, L., Batur, D., Long, H., Tarbashevich, K., Vos, B.E., Trappmann, B., Raz, E. (2022) Primordial germ cells adjust their protrusion type while migrating in different tissue contexts in vivo. Development (Cambridge, England). 150(2):
- Marsay, K.S., Greaves, S., Mahabaleshwar, H., Ho, C.M., Roehl, H., Monk, P.N., Carney, T.J., Partridge, L.J. (2021) Tetraspanin Cd9b and Cxcl12a/Cxcr4b have a synergistic effect on the control of collective cell migration. PLoS One. 16:e0260372
- Olguin-Olguin, A., Aalto, A., Maugis, B., Boquet-Pujadas, A., Hoffmann, D., Ermlich, L., Betz, T., Gov, N.S., Reichman-Fried, M., Raz, E. (2021) Chemokine-biased robust self-organizing polarization of migrating cells in vivo. Proceedings of the National Academy of Sciences of the United States of America. 118(7):
- Malhotra, D., Shin, J., Solnica-Krezel, L., Raz, E. (2018) Spatio-temporal regulation of concurrent developmental processes by generic signaling downstream of chemokine receptors. eLIFE. 7
- Neelathi, U.M., Dalle Nogare, D., Chitnis, A.B. (2018) Cxcl12a induces snail1b expression to initiate collective migration and sequential Fgf-dependent neuromast formation in the zebrafish posterior lateral line primordium.. Development (Cambridge, England). 145(14):
- Gross-Thebing, T., Yigit, S., Pfeiffer, J., Reichman-Fried, M., Bandemer, J., Ruckert, C., Rathmer, C., Goudarzi, M., Stehling, M., Tarbashevich, K., Seggewiss, J., Raz, E. (2017) The Vertebrate Protein Dead End Maintains Primordial Germ Cell Fate by Inhibiting Somatic Differentiation. Developmental Cell. 43:704-715.e5
- Paksa, A., Bandemer, J., Hoeckendorf, B., Razin, N., Tarbashevich, K., Minina, S., Meyen, D., Biundo, A., Leidel, S.A., Peyrieras, N., Gov, N.S., Keller, P.J., Raz, E. (2016) Repulsive cues combined with physical barriers and cell-cell adhesion determine progenitor cell positioning during organogenesis. Nature communications. 7:11288
- Meyen, D., Tarbashevich, K., Banisch, T.U., Wittwer, C., Reichman-Fried, M., Maugis, B., Grimaldi, C., Messerschmidt, E.M., Raz, E. (2015) Dynamic filopodia are required for chemokine-dependent intracellular polarization during guided cell migration in vivo. eLIFE. 4
- Tarbashevich, K., Reichman-Fried, M., Grimaldi, C., Raz, E. (2015) Chemokine-Dependent pH Elevation at the Cell Front Sustains Polarity in Directionally Migrating Zebrafish Germ Cells. Current biology : CB. 25(8):1096-103
1 - 10 of 25
Show