Morpholino

MO1-cxcl12b

ID
ZDB-MRPHLNO-051028-1
Name
MO1-cxcl12b
Previous Names
  • cxcl12b MORPH 1736 (1)
Target
Sequence
5' - CGCTACTACTTTGCTATCCATGCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcl12b
Expressed Gene Anatomy Figures
cp Fig. S3 from Nair et al., 2008
dlx3b Fig. S3 from Nair et al., 2008
foxa2 Fig. 1 from Nair et al., 2008
foxa3 Fig. S3 from Nair et al., 2008
hand2 Fig. S3,  Fig. S4 from Nair et al., 2008
ins Fig. S3 from Nair et al., 2008
kdrl Fig. 4 with image from Siekmann et al., 2009
pax2a Fig. 5 from Lewellis et al., 2013
sox32 Fig. 1,  Fig. S6 from Nair et al., 2008
tbx16 Fig. S4 from Nair et al., 2008
tbxta Fig. 1 from Nair et al., 2008
Phenotype
Phenotype resulting from MO1-cxcl12b
Phenotype Fish Figures
axon guidance process quality, abnormal WT + MO1-cxcl12b Fig. S4 from Hollway et al., 2007
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO1-cxcl12b Fig. S2 with image from Mizoguchi et al., 2008
endodermal cell displaced to margin, abnormal WT + MO1-cxcl12b Fig. 1 from Nair et al., 2008
endodermal cell mislocalised anteriorly, abnormal WT + MO1-cxcl12b Fig. 1 from Nair et al., 2008
intestine duplicated, abnormal WT + MO1-cxcl12b Fig. 1 from Nair et al., 2008
lateral dorsal aorta malformed, abnormal WT + MO1-cxcl12b Fig. 4 with image,  Fig. S7 with image from Siekmann et al., 2009
liver duplicated, abnormal s854Tg + MO1-cxcl12b Fig. 1 from Nair et al., 2008
pancreas duplicated, abnormal s854Tg + MO1-cxcl12b Fig. 1 from Nair et al., 2008
somite cellular quality, abnormal WT + MO1-cxcl12b Fig. 6 from Hollway et al., 2007
trigeminal ganglion axon position, abnormal WT + MO1-cxcl12b Fig. S4 from Hollway et al., 2007
vasculogenesis process quality, abnormal WT + MO1-cxcl12b Fig. 4 with image,  Fig. S7 with image from Siekmann et al., 2009
Phenotype of all Fish created by or utilizing MO1-cxcl12b
Phenotype Fish Conditions Figures
endodermal cell mislocalised anteriorly, abnormal WT + MO1-cxcl12b standard conditions Fig. 1 from Nair et al., 2008
trigeminal ganglion axon position, abnormal WT + MO1-cxcl12b standard conditions Fig. S4 from Hollway et al., 2007
intestine duplicated, abnormal WT + MO1-cxcl12b standard conditions Fig. 1 from Nair et al., 2008
somite cellular quality, abnormal WT + MO1-cxcl12b standard conditions Fig. 6 from Hollway et al., 2007
axon guidance process quality, abnormal WT + MO1-cxcl12b standard conditions Fig. S4 from Hollway et al., 2007
endodermal cell displaced to margin, abnormal WT + MO1-cxcl12b standard conditions Fig. 1 from Nair et al., 2008
vasculogenesis process quality, abnormal WT + MO1-cxcl12b standard conditions Fig. 4 with image from Siekmann et al., 2009
lateral dorsal aorta malformed, abnormal WT + MO1-cxcl12b standard conditions Fig. 4 with image from Siekmann et al., 2009
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO1-cxcl12b standard conditions Fig. S2 with image from Mizoguchi et al., 2008
lateral dorsal aorta malformed, abnormal la116Tg + MO1-cxcl12b standard conditions Fig. S7 with image from Siekmann et al., 2009
vasculogenesis process quality, abnormal la116Tg + MO1-cxcl12b standard conditions Fig. S7 with image from Siekmann et al., 2009
pancreas duplicated, abnormal s854Tg + MO1-cxcl12b standard conditions Fig. 1 from Nair et al., 2008
liver duplicated, abnormal s854Tg + MO1-cxcl12b standard conditions Fig. 1 from Nair et al., 2008
trigeminal sensory neuron mislocalised, abnormal cxcl12at30516/t30516 + MO1-cxcl12b standard conditions Fig. 5 from Lewellis et al., 2013
trigeminal sensory neuron cell migration process quality, abnormal cxcl12at30516/t30516 + MO1-cxcl12b standard conditions Fig. 5 from Lewellis et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal robo2te284/te284 + MO1-cxcl12b standard conditions Fig. 2 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal robo2te284/te284 + MO1-cxcl12b standard conditions Fig. 2 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal robo2ti272z/ti272z + MO1-cxcl12b standard conditions Fig. 2 from Chalasani et al., 2007
retinal ganglion cell axon guidance disrupted, abnormal robo2ti272z/ti272z + MO1-cxcl12b standard conditions Fig. 2 from Chalasani et al., 2007
pancreas morphology, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
gut morphology, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas decreased size, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas pancreatic B cell dispersed, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
liver decreased size, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
axon guidance process quality, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
somite cellular quality, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
trigeminal ganglion axon position, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
endodermal cell circular, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium orientation whole organism dorsal-ventral axis, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium decreased amount, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
gut bifurcated, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image,  Fig. S2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation process quality, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
neutrophil mislocalised, abnormal uwm3Tg + MO1-cxcl12b standard conditions Fig. 4 from Walters et al., 2010
head neutrophil aggregated, abnormal uwm3Tg + MO1-cxcl12b standard conditions Fig. 4 from Walters et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.