Morpholino

MO1-tbx2b

ID

ZDB-MRPHLNO-050928-1

Name

MO1-tbx2b

Previous Names

Target

Sequence

5' - CCTGTAAAAACTGGATCTCTCATCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbx2b

Expressed Gene	Anatomy	Figures
emx1	pronephric duct	Fig. 7 from Morales et al., 2018
gfi1ab	(not) parapineal organ	Fig. 3 from Doll et al., 2011
kctd12.1	dorsal habenular nucleus lateral region	Fig. 3 from Doll et al., 2011
mecom	pronephric duct	Fig. 8 from Morales et al., 2018
ppargc1a	pronephric duct	Fig. 4 from Chambers et al., 2018
slc12a3	pronephric distal late tubule	Fig. 7 from Morales et al., 2018

Phenotype

Phenotype resulting from MO1-tbx2b

Phenotype	Fish	Figures
dorsal habenular nucleus lateral region has extra parts of type neuron, abnormal	AB + MO1-tbx2b	Fig. 3 from Doll et al., 2011
dorsal habenular nucleus right side has extra parts of type neuron, abnormal	AB + MO1-tbx2b	Fig. 3 from Doll et al., 2011
parapineal organ aplastic, abnormal	AB + MO1-tbx2b	Fig. 3 from Doll et al., 2011
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	WT + MO1-tbx2b	Fig. 7 from Morales et al., 2018
pronephric distal late tubule decreased length, abnormal	WT + MO1-tbx2b	Fig. 7 from Morales et al., 2018
pronephric duct emx1 expression decreased distribution, abnormal	WT + MO1-tbx2b	Fig. 7 from Morales et al., 2018

Phenotype of all Fish created by or utilizing MO1-tbx2b

Phenotype	Fish	Conditions	Figures
dorsal habenular nucleus lateral region has extra parts of type neuron, abnormal	AB + MO1-tbx2b	standard conditions	Fig. 3 from Doll et al., 2011
parapineal organ aplastic, abnormal	AB + MO1-tbx2b	standard conditions	Fig. 3 from Doll et al., 2011
dorsal habenular nucleus right side has extra parts of type neuron, abnormal	AB + MO1-tbx2b	standard conditions	Fig. 3 from Doll et al., 2011
pronephric distal late tubule decreased length, abnormal	WT + MO1-tbx2b	standard conditions	Fig. 7 from Morales et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	WT + MO1-tbx2b	standard conditions	Fig. 7 from Morales et al., 2018
pronephric duct emx1 expression decreased distribution, abnormal	WT + MO1-tbx2b	standard conditions	Fig. 7 from Morales et al., 2018
dorsal habenular nucleus right side has extra parts of type neuron, abnormal	sec61a1a^c163/c163 + MO1-tbx2b (AB)	standard conditions	Fig. 3 from Doll et al., 2011
dorsal habenular nucleus lateral region has extra parts of type neuron, abnormal	sec61a1a^c163/c163 + MO1-tbx2b (AB)	standard conditions	Fig. 3 from Doll et al., 2011
parapineal organ aplastic, abnormal	sec61a1a^c163/c163 + MO1-tbx2b (AB)	standard conditions	Fig. 3 from Doll et al., 2011

Citations