Morpholino
MO1-axin1
- ID
- ZDB-MRPHLNO-050923-2
- Name
- MO1-axin1
- Previous Names
-
- axin1 MO (1)
- Target
- Sequence
-
5' - CATAGTGTCCCTGCACTCTGTCCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the gene axin1.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-axin1
No data available
Phenotype
Phenotype resulting from MO1-axin1
| Phenotype | Fish | Figures |
|---|---|---|
| heart linear, abnormal | AB + MO1-axin1 |
Fig. S2 
from Lee et al., 2007 |
| heart looping disrupted, abnormal | AB + MO1-axin1 |
Fig. S2
from Lee et al., 2007 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-axin1
1 - 5 of 16 Show all
Citations
- Lee, H.C., Tsai, J.N., Liao, P.Y., Tsai, W.Y., Lin, K.Y., Chuang, C.C., Sun, C.K., Chang, W.C., and Tsai, H.J. (2007) Glycogen synthase kinase 3alpha and 3beta have distinct functions during cardiogenesis of zebrafish embryo. BMC Developmental Biology. 7(1):93
- Fong, S.H., Emelyanov, A., Teh, C., and Korzh, V. (2005) Wnt signalling mediated by Tbx2b regulates cell migration during formation of the neural plate. Development (Cambridge, England). 132(16):3587-3596
1 - 2 of 2
Show