header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050902-1
Morpholino Name: MO1-bmp5
Target: bmp5 (1)
Sequence:
5' - CCACAGAAGTTCCAAATGTTCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This sequence contains an extra T compared to NM_201051. This was confirmed by the authors.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-bmp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-bmp5 No data available
PHENOTYPE
Phenotype resulting from MO1-bmp5
Phenotype of all Fish created by or utilizing MO1-bmp5
Genome Resources:
CITATIONS (2)