Morpholino
MO1-hoxb1b
- ID
- ZDB-MRPHLNO-050825-2
- Name
- MO1-hoxb1b
- Previous Names
- None
- Target
- Sequence
-
5' - AATTCATTGTTGACTGACCAAGCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hoxb1b
No data available
Phenotype
Phenotype resulting from MO1-hoxb1b
No data available
Phenotype of all Fish created by or utilizing MO1-hoxb1b
1 - 5 of 14 Show all
Citations
- Addison, M., Xu, Q., Cayuso, J., Wilkinson, D.G. (2018) Cell Identity Switching Regulated by Retinoic Acid Signaling Maintains Homogeneous Segments in the Hindbrain. Developmental Cell. 45:606-620.e3
- Labalette, C., Wassef, M.A., Desmarquet-Trin Dinh, C., Bouchoucha, Y.X., Le Men, J., Charnay, P., Gilardi-Hebenstreit, P. (2015) Molecular dissection of segment formation in the developing hindbrain. Development (Cambridge, England). 142:185-95
- Choe, S.K., Ladam, F., and Sagerström, C.G. (2014) TALE factors poise promoters for activation by Hox proteins. Developmental Cell. 28(2):203-211
- Erickson, T., Pillay, L.M., and Waskiewicz, A.J. (2011) Zebrafish Tshz3b negatively regulates Hox function in the developing hindbrain. Genesis (New York, N.Y. : 2000). 49(9):725-42
- Stedman, A., Lecaudey, V., Havis, E., Anselme, I., Wassef, M., Gilardi-Hebenstreit, P., and Schneider-Maunoury, S. (2009) A functional interaction between Irx and Meis patterns the anterior hindbrain and activates krox20 expression in rhombomere 3. Developmental Biology. 327(2):566-577
- French, C.R., Erickson, T., Callander, D., Berry, K.M., Koss, R., Hagey, D.W., Stout, J., Wuennenberg-Stapleton, K., Ngai, J., Moens, C.B., and Waskiewicz, A.J. (2007) Pbx homeodomain proteins pattern both the zebrafish retina and tectum. BMC Developmental Biology. 7(1):85
- Choe, S.K., and Sagerström, C.G. (2005) Variable Meis-dependence among paralog group-1 Hox proteins. Biochemical and Biophysical Research Communications. 331(4):1384-1391
- McClintock, J.M., Kheirbek, M.A., and Prince, V.E. (2002) Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development (Cambridge, England). 129(10):2339-2354
1 - 8 of 8
Show