Morpholino

MO1-lmx1ba

ID
ZDB-MRPHLNO-050824-4
Name
MO1-lmx1ba
Previous Names
  • MO1-lmx1b.2
Target
Sequence
5' - CCTCAATTTTGATTCCGTCCAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lmx1ba
No data available
Phenotype
Phenotype resulting from MO1-lmx1ba
Phenotype of all Fish created by or utilizing MO1-lmx1ba
Phenotype Fish Conditions Figures
fourth ventricle development disrupted, abnormal AB + MO1-lmx1ba standard conditions Fig. 5 with image from Elsen et al., 2008
fourth ventricle structure, abnormal AB + MO1-lmx1ba standard conditions Fig. 5 with image from Elsen et al., 2008
pronephric glomerulus physical object characteristic, abnormal ki1Tg + MO1-lmx1ba standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1ba standard conditions Fig. 3 from He et al., 2014
whole organism th expression decreased amount, abnormal AB + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from Katherine et al., 2013
whole organism nr4a2a expression decreased amount, abnormal AB + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from Katherine et al., 2013
whole organism nr4a2a expression decreased amount, abnormal AB + MO1-lmx1ba + MO1-lmx1bb chemical treatment by environment: cocaine hydrochloride Fig. 3 from Katherine et al., 2013
whole organism th expression amount, ameliorated AB + MO1-lmx1ba + MO1-lmx1bb chemical treatment by environment: cocaine hydrochloride Fig. 3 from Katherine et al., 2013
cerebellum aplastic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
pericardium edematous, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
blood circulation disrupted, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
hindbrain apoptotic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
midbrain hindbrain boundary aplastic, abnormal TL + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 4 with image from O'Hara et al., 2005
diencephalon has fewer parts of type dopaminergic neuron, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
brain dopaminergic neuron mislocalised, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
area postrema has fewer parts of type dopaminergic neuron, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
diencephalon dopaminergic neuron mislocalised laterally, abnormal WT + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 6 with image from Filippi et al., 2007
pronephric glomerulus physical object characteristic, abnormal ki1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 3 from He et al., 2014
whole organism edematous, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus cystic, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
heart edematous, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus morphogenesis process characteristic, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
post-vent region coiled, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
trunk curved, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus split bilaterally, abnormal li1Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
oculomotor nucleus aplastic, abnormal rw0Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
trochlear motor nucleus aplastic, abnormal rw0Tg + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 7 with image from O'Hara et al., 2005
post-vent region coiled, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus split bilaterally, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus cystic, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
trunk curved, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
heart edematous, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
whole organism edematous, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephric glomerulus morphogenesis process characteristic, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
pronephros lacks all parts of type pronephric glomerulus, abnormal li1Tg + MO1-abrab + MO1-lmx1ba + MO1-lmx1bb standard conditions Fig. 9 from Burghardt et al., 2013
Citations