Morpholino
MO1-her1
- ID
- ZDB-MRPHLNO-050526-3
- Name
- MO1-her1
- Previous Names
-
- her1m1 (1)
- Target
- Sequence
-
5' - TTCGACTTGCCATTTTTGGAGTAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-her1
No data available
Phenotype
Phenotype resulting from MO1-her1
No data available
Phenotype of all Fish created by or utilizing MO1-her1
from
Citations
- Naoki, H., Akiyama, R., Sari, D.W.K., Ishii, S., Bessho, Y., Matsui, T. (2019) Noise-resistant developmental reproducibility in vertebrate somite formation. PLoS Computational Biology. 15:e1006579
- Sari, D.W.K., Akiyama, R., Naoki, H., Ishijima, H., Bessho, Y., Matsui, T. (2018) Time-lapse observation of stepwise regression of Erk activity in zebrafish presomitic mesoderm. Scientific Reports. 8:4335
- Akiyama, R., Masuda, M., Tsuge, S., Bessho, Y., and Matsui, T. (2014) An anterior limit of FGF/Erk signal activity marks the earliest future somite boundary in zebrafish. Development (Cambridge, England). 141(5):1104-1109
- Schröter, C., and Oates, A.C. (2010) Segment Number and Axial Identity in a Segmentation Clock Period Mutant. Current biology : CB. 20(14):1254-1258
- Riedel-Kruse, I.H., Müller, C., and Oates, A.C. (2007) Synchrony Dynamics During Initiation, Failure, and Rescue of the Segmentation Clock. Science (New York, N.Y.). 317(5846):1911-1915
- Horikawa, K., Ishimatsu, K., Yoshimoto, E., Kondo, S., and Takeda, H. (2006) Noise-resistant and synchronized oscillation of the segmentation clock. Nature. 441(7094):719-723
- Oates, A.C. and Ho, R.K. (2002) Hairy/E(spl)-related (Her) genes are central components of the segmentation oscillator and display redundancy with the Delta/Notch signaling pathway in the formation of anterior segmental boundaries in the zebrafish. Development (Cambridge, England). 129(12):2929-2946
1 - 7 of 7
Show