Morpholino
MO1-nrp1a
- ID
- ZDB-MRPHLNO-050513-9
- Name
- MO1-nrp1a
- Previous Names
- None
- Target
- Sequence
-
5' - GAGGATCAACACTAATCCACAATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nrp1a
No data available
Phenotype
Phenotype resulting from MO1-nrp1a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-nrp1a
1 - 5 of 6 Show all
Citations
- Hamm, M.J., Kirchmaier, B.C., Herzog, W. (2016) Sema3d controls collective endothelial cell migration by distinct mechanisms via Nrp1 and PlxnD1. The Journal of cell biology. 215(3):415-430
- Jensen, L.D., Nakamura, M., Bräutigam, L., Li, X., Liu, Y., Samani, N.J., Cao, Y. (2015) VEGF-B-Neuropilin-1 signaling is spatiotemporally indispensable for vascular and neuronal development in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 112(44):E5944-53
- Tanaka, H., Maeda, R., Shoji, W., Wada, H., Masai, I., Shiraki, T., Kobayashi, M., Nakayama, R., and Okamoto, H. (2007) Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons. Development (Cambridge, England). 134(18):3259-3269
- Yu, H.H., and Moens, C.B. (2005) Semaphorin signaling guides cranial neural crest cell migration in zebrafish. Developmental Biology. 280(2):373-385
1 - 4 of 4
Show