Morpholino

MO3-ift88

ID
ZDB-MRPHLNO-050513-1
Name
MO3-ift88
Previous Names
  • ift88ATG (1)
  • MO3-ttc10 (1)
Target
Sequence
5' - GCCTTATTAAACAGAAATACTCCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targeted to 5' UTR of ift88 (ttc10). This morpholino was used in studies reported in ZDB-PUB-080527-11 but was cited with a typo in the Materials and Methods that left off the first three nucleotides (GCC).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ift88
No data available
Phenotype
Phenotype resulting from MO3-ift88
Phenotype of all Fish created by or utilizing MO3-ift88
Phenotype Fish Conditions Figures
otic vesicle cilium decreased amount, abnormal WT + MO3-ift88 standard conditions Fig. 2 with image from Lunt et al., 2009
retinal outer nuclear layer eye photoreceptor cell apoptotic, abnormal WT + MO3-ift88 standard conditions Fig. 1 from Krock et al., 2008
otic vesicle decreased size, abnormal WT + MO3-ift88 standard conditions Fig. 2 with image from Lunt et al., 2009
retinal outer nuclear layer perforate, abnormal WT + MO3-ift88 standard conditions Fig. 1 from Krock et al., 2008
pronephros cystic, abnormal WT + MO3-ift88 standard conditions Fig. S1 from Krock et al., 2008
eye decreased size, abnormal WT + MO3-ift88 standard conditions Fig. S1 from Krock et al., 2008
otic vesicle cilium decreased length, abnormal WT + MO3-ift88 standard conditions Fig. 2 with image from Lunt et al., 2009
retina photoreceptor outer segment absent, abnormal WT + MO3-ift88 standard conditions Fig. 1 from Krock et al., 2008
cilium assembly disrupted, abnormal WT + MO3-ift88 standard conditions Fig. 2 with image from Lunt et al., 2009
neural tube axoneme absent, abnormal WT + MO3-ift88 standard conditions Fig. 2 with image from Lunt et al., 2009
post-vent region curved ventral, abnormal WT + MO3-ift88 standard conditions Fig. S1 from Krock et al., 2008
heart notch1b expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
trabecular layer absent, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
cardiac ventricle Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
atrioventricular canal endocardium Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
Citations