Morpholino

MO1-ved

ID

ZDB-MRPHLNO-050509-6

Name

MO1-ved

Previous Names

ved MO (1)
vedMO (1)

Target

ved (1)

Sequence

5' - ACTCGATGGAGAACTGACCCTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ved

Expressed Gene	Anatomy	Figures
myod1	mesoderm	Fig. 6 from Ramel et al., 2005

Phenotype

Phenotype resulting from MO1-ved

No data available

Phenotype of all Fish created by or utilizing MO1-ved

Phenotype	Fish	Conditions	Figures
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-eve1 + MO1-ved	standard conditions	Fig. 3 from Seebald et al., 2011
whole organism wholly dorsalized, abnormal	AB + MO1-eve1 + MO1-ved	standard conditions	Fig. 3 from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal	AB + MO1-eve1 + MO1-ved	standard conditions	Fig. 4 from Seebald et al., 2011
caudal fin duplicated, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 7 from Seebald et al., 2011
tail bud duplicated, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 7 from Seebald et al., 2011
somite increased width, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 7 from Seebald et al., 2011
tail bud mislocalised, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 7 from Seebald et al., 2011
embryonic pattern specification process quality, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 5 from Seebald et al., 2011
caudal fin mislocalised, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 7 from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 2 from Seebald et al., 2011
whole organism wholly dorsalized, abnormal	AB + MO1-ved + MO2-eve1	standard conditions	Fig. 2 from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 2 from Seebald et al., 2011
presumptive mesoderm tbx16l expression decreased distribution, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
presumptive mesoderm tbx16l expression spatial pattern, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
whole organism wholly dorsalized, abnormal	AB + MO1-ved + MO1-vent + MO2-eve1	standard conditions	Fig. 2 from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal	AB + MO1-ved + MO1-vox + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal	AB + MO1-ved + MO1-vox + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal	AB + MO1-ved + MO1-vox + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal	AB + MO1-ved + MO1-vox + MO2-eve1	standard conditions	Fig. 6 from Seebald et al., 2011

Citations