Morpholino
MO1-ift57
- ID
- ZDB-MRPHLNO-050506-3
- Name
- MO1-ift57
- Previous Names
-
- hippiAUG (1)
- Target
- Sequence
-
5' - CCTCCGCCATCCCTCTCTCTTTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the ift57 gene.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift57
No data available
Phenotype
Phenotype resulting from MO1-ift57
| Phenotype | Fish | Figures |
|---|---|---|
| heart tube position, abnormal | WT + MO1-ift57 |
Fig. S7 
from Sarmah et al., 2007 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-ift57
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart tube position, abnormal | WT + MO1-ift57 | standard conditions |
Fig. S7
from Sarmah et al., 2007 |
| heart tube position, abnormal | WT + MO1-ift57 + MO1-ippk | standard conditions |
Fig. 3 ,
Fig. S7
from Sarmah et al., 2007 |
1 - 2 of 2
Citations
- Sarmah, B., Winfrey, V.P., Olson, G.E., Appel, B., and Wente, S.R. (2007) A role for the inositol kinase Ipk1 in ciliary beating and length maintenance. Proceedings of the National Academy of Sciences of the United States of America. 104(50):19843-19848
- Kramer-Zucker, A.G., Olale, F., Haycraft, C.J., Yoder, B.K., Schier, A.F., and Drummond, I.A. (2005) Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer's vesicle is required for normal organogenesis. Development (Cambridge, England). 132(8):1907-1921
1 - 2 of 2
Show