Morpholino
MO1-her9
- ID
- ZDB-MRPHLNO-050503-1
- Name
- MO1-her9
- Previous Names
- None
- Target
- Sequence
-
5' - CTCCATATTATCGGCTGGCATGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino is designed against the start site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-her9
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| atoh1a |
Fig. 5 
from Bae et al., 2005 |
|
| neurod4 |
Fig. 5
from Bae et al., 2005 |
Phenotype
Phenotype resulting from MO1-her9
No data available
Phenotype of all Fish created by or utilizing MO1-her9
No data available
Citations
- Yamamoto, M., Morita, R., Mizoguchi, T., Matsuo, H., Isoda, M., Ishitani, T., Chitnis, A.B., Matsumoto, K., Crump, J.G., Hozumi, K., Yonemura, S., Kawakami, K., and Itoh, M. (2010) Mib-Jag1-Notch signalling regulates patterning and structural roles of the notochord by controlling cell-fate decisions. Development (Cambridge, England). 137(15):2527-2537
- Ma, M., and Jiang, Y.J. (2007) Jagged2a-notch signaling mediates cell fate choice in the zebrafish pronephric duct. PLoS Genetics. 3(1):e18
- Bae, Y.K., Shimizu, T., and Hibi, M. (2005) Patterning of proneuronal and inter-proneuronal domains by hairy- and enhancer of split-related genes in zebrafish neuroectoderm. Development (Cambridge, England). 132(6):1375-1385
1 - 3 of 3
Show