ZFIN ID: ZDB-MRPHLNO-050429-3
Morpholino Name: MO2-bmp4
Target: bmp4 (1)
Sequence:
5' - GTCTCGACAGAAGATAAAGCATGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-bmp4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-bmp4
Expressed Gene Anatomy Figures
en1a Fig. 4 from Kawakami et al., 2005
nkx2.2a Fig. 4 from Kawakami et al., 2005
pax2a Fig. 6 from Weber et al., 2008
wt1a Fig. 6Fig. 7 from Weber et al., 2008
PHENOTYPE
Phenotype resulting from MO2-bmp4
Phenotype of all Fish created by or utilizing MO2-bmp4
Genome Resources:
CITATIONS (2)