header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050429-1
Morpholino Name: MO2-prdm1a
Target: prdm1a (1)
Previous Names: E2I2 prdm1-MO (1), MO2-prdm1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGTGTCATACCTCTTTGGAGTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: exon 2 - intron 2 splice-blocking MO
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-prdm1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-prdm1a
Expressed Gene Anatomy Figures
crestin Fig. 2 with image from Hernandez-Lagunas et al., 2005
dlx2a Fig. 3 from LaMonica et al., 2015
Fig. 8 with image from Lee et al., 2006
elavl3 Fig. 2 with image from Hernandez-Lagunas et al., 2005
fgf8a Fig. 8 with image from Lee et al., 2006
fgf10a Fig. 6 with image from Lee et al., 2006
fgf24 Fig. 5 with image from Lee et al., 2006
foxd3 Fig. 2 with image from Hernandez-Lagunas et al., 2005
isl1 Fig. 6 with image from Liu et al., 2012
isl2a Fig. 6 with image from Liu et al., 2012
mnx1 Fig. 6 with image from Liu et al., 2012
mylpfa Fig. 5 with image from Liew et al., 2008
shha Fig. 7 with image from Lee et al., 2006
tbx5a Fig. 5 with image from Lee et al., 2006
PHENOTYPE
Phenotype resulting from MO2-prdm1a
Phenotype of all Fish created by or utilizing MO2-prdm1a
Phenotype Fish Conditions Figures
pharyngeal arch 4 decreased object quality, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
pharyngeal arch 3 decreased object quality, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
pharyngeal arch cartilage has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-prdm1a standard conditions Fig. 3 from LaMonica et al., 2015
neurocranium decreased width, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
developmental growth decreased rate, abnormal WT + MO2-prdm1a control Fig. 6 from Kamei et al., 2018
developmental growth decreased rate, abnormal WT + MO2-prdm1a oxygen content, hypoxia Fig. 6 from Kamei et al., 2018
neurocranial trabecula shortened, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
pectoral fin skeleton aplastic, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
pectoral fin bud hypoplastic, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
developmental growth decreased rate, abnormal WT + MO2-prdm1a hypoxia Fig. 6 from Kamei et al., 2018
cleithrum decreased size, abnormal WT + MO2-prdm1a standard conditions Fig. 3 with image from Lee et al., 2006
ceratohyal cartilage inverted, abnormal WT + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Meckel's cartilage shortened, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-mecom + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Meckel's cartilage shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
OTHER MO2-prdm1a MORPHOLINO PAGESNo links to external sites
CITATIONS (12)