Morpholino

MO2-wnt11f2

ID
ZDB-MRPHLNO-050318-3
Name
MO2-wnt11f2
Previous Names
  • MO2-wnt11
  • wnt11-MO (1)
Target
Sequence
5' - GTTCCTGTATTCTGTCATGTCGCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the translation start site of wnt11.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt11f2
No data available
Phenotype
Phenotype resulting from MO2-wnt11f2
Phenotype of all Fish created by or utilizing MO2-wnt11f2
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
eye fused with eye, abnormal WT + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
eye mislocalised, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension process quality, abnormal WT + MO2-wnt11f2 standard conditions Fig. 3 from Bai et al., 2014
eye malformed, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye malformed, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
eye fused with eye, abnormal WT + MO1-tmem88a + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
eye fused with eye, abnormal WT + MO2-tmem88a + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
cardiac muscle tissue morphogenesis process quality, abnormal WT + MO2-wnt11f2 + MO2-wnt5b control Fig. 2 from Merks et al., 2018
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart calcium-mediated signaling process quality, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
whole organism Luciferase expression increased amount, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
heart decreased functionality, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
convergent extension disrupted, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
Citations