Morpholino
MO2-wnt11f2
- ID
- ZDB-MRPHLNO-050318-3
- Name
- MO2-wnt11f2
- Previous Names
-
- MO2-wnt11
- wnt11-MO (1)
- Target
- Sequence
-
5' - GTTCCTGTATTCTGTCATGTCGCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the translation start site of wnt11.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt11f2
No data available
Phenotype
Phenotype resulting from MO2-wnt11f2
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO2-wnt11f2
1 - 5 of 51 Show all
Citations
- De Jong, H.N., Dewey, F.E., Cordero, P., Victorio, R.A., Kirillova, A., Huang, Y., Madhvani, R., Seo, K., Werdich, A.A., Lan, F., Orcholski, M., Robert Liu, W., Erbilgin, A., Wheeler, M.T., Chen, R., Pan, S., Kim, Y.M., Bommakanti, K., Marcou, C.A., Martijn Bos, J., Haddad, F., Ackerman, M., Vasan, R.S., MacRae, C., Wu, J.C., de Jesus Perez, V., Snyder, M., Parikh, V.N., Ashley, E.A. (2022) Wnt Signaling Interactor WTIP (Wilms Tumor Interacting Protein) Underlies Novel Mechanism for Cardiac Hypertrophy. Circulation. Genomic and precision medicine. 15(4):e003563
- Merks, A.M., Swinarski, M., Meyer, A.M., Müller, N.V., Özcan, I., Donat, S., Burger, A., Gilbert, S., Mosimann, C., Abdelilah-Seyfried, S., Panáková, D. (2018) Planar cell polarity signalling coordinates heart tube remodelling through tissue-scale polarisation of actomyosin activity. Nature communications. 9:2161
- Bai, Y., Tan, X., Zhang, H., Liu, C., Zhao, B., Li, Y., Lu, L., Liu, Y., Zhou, J. (2014) Ror2 Receptor Mediates Wnt11 Signaling and Affects Convergence and Extension Movements in Zebrafish. The Journal of biological chemistry. 289(30):20664-20676
- Musso, G., Tasan, M., Mosimann, C., Beaver, J.E., Plovie, E., Carr, L.A., Chua, H.N., Dunham, J., Zuberi, K., Rodriguez, H., Morris, Q., Zon, L., Roth, F.P., and MacRae, C.A. (2014) Novel cardiovascular gene functions revealed via systematic phenotype prediction in zebrafish. Development (Cambridge, England). 141(1):224-235
- Young, T., Poobalan, Y., Tan, E.K., Tao, S., Ong, S., Wehner, P., Schwenty-Lara, J., Lim, C.Y., Sadasivam, A., Lovatt, M., Wang, S.T., Ali, Y., Borchers, A., Sampath, K., Dunn, N.R. (2014) The PDZ domain protein Mcc is a novel effector of non-canonical Wnt signaling during convergence and extension in zebrafish. Development (Cambridge, England). 141:3505-16
- Panáková, D., Werdich, A.A., and MacRae, C.A. (2010) Wnt11 patterns a myocardial electrical gradient through regulation of the L-type Ca(2+) channel. Nature. 466(7308):874-878
- Pei, W., and Feldman, B. (2009) Identification of common and unique modifiers of zebrafish midline bifurcation and cyclopia. Developmental Biology. 326(1):201-211
- Vervenne, H.B., Crombez, K.R., Lambaerts, K., Carvalho, L., Koeppen, M., Heisenberg, C.P., Van de Ven, W.J., and Petit, M.M. (2008) Lpp is involved in Wnt/PCP signaling and acts together with Scrib to mediate convergence and extension movements during zebrafish gastrulation. Developmental Biology. 320(1):267-277
- Yao, S., Xie, L., Qian, M., Yang, H., Zhou, L., Zhou, Q., Yan, F., Gou, L., Wei, Y., Zhao, X., and Mo, X. (2008) Pnas4 is a novel regulator for convergence and extension during vertebrate gastrulation. FEBS letters. 582(15):2325-2332
- Matsui, T., Raya, A., Kawakami, Y., Callol-Massot, C., Capdevila, J., Rodriguez-Esteban, C., Izpisúa Belmonte, J.C. (2005) Noncanonical Wnt signaling regulates midline convergence of organ primordia during zebrafish development. Genes & Development. 19(1):164-175
1 - 10 of 10
Show