header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050318-3
Morpholino Name: MO2-wnt11
Target: wnt11f2 (1)
Previous Name: wnt11-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTCCTGTATTCTGTCATGTCGCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino targeting the translation start site of wnt11.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-wnt11 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-wnt11
Expressed Gene Anatomy Figures
lpp Fig. 5 with image from Vervenne et al., 2008
PHENOTYPE
Phenotype resulting from MO2-wnt11
Phenotype of all Fish created by or utilizing MO2-wnt11
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
convergent extension process quality, abnormal WT + MO2-wnt11 standard conditions Fig. 3 from Bai et al., 2014
eye fused with eye, abnormal WT + MO2-wnt11 standard conditions Fig. 4 with image from Musso et al., 2014
eye malformed, abnormal WT + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal WT + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal WT + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
eye malformed, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11 standard conditions Fig. 7 with image from Pei et al., 2009
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11r + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11r + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11r + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11r + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11 standard conditions Fig. 7 from Yao et al., 2008
eye fused with eye, abnormal WT + MO1-tmem88a + MO2-wnt11 standard conditions Fig. 4 with image from Musso et al., 2014
eye fused with eye, abnormal WT + MO2-tmem88a + MO2-wnt11 standard conditions Fig. 4 with image from Musso et al., 2014
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 5 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11r + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11r + MO1-wnt4a + MO2-wnt11 standard conditions Fig. 3 from Matsui et al., 2005
OTHER MO2-wnt11 MORPHOLINO PAGESNo links to external sites
CITATIONS (9)