Morpholino

MO1-stk36

ID
ZDB-MRPHLNO-050308-9
Name
MO1-stk36
Previous Names
  • fu MO1 (1)
Target
Sequence
5' - TGGTACTGATCCATCTCCAGCGACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting stk36.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-stk36
No data available
Phenotype
Phenotype resulting from MO1-stk36
Phenotype Fish Figures
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3Fig. S11 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 text only from Wilson et al., 2009
fast muscle cell increased amount, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2Fig. S5 from Wilson et al., 2009
growth delayed, abnormal TU + MO1-stk36 Fig. 7 with image from Xia et al., 2010
gut position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3Fig. S11 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 3 from Wilson et al., 2009
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2Fig. S5 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S5 from Wilson et al., 2009
muscle pioneer absent, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
nervous system necrotic, abnormal TU + MO1-stk36 Fig. 7 with image from Xia et al., 2010
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 Fig. S11 from Wilson et al., 2009
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-stk36 Fig. 6 from Wolff et al., 2003
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 Fig. 2 from Wilson et al., 2009
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 Fig. 7 with image from Xia et al., 2010
Phenotype of all Fish created by or utilizing MO1-stk36
Phenotype Fish Conditions Figures
lateral floor plate aplastic, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
floor plate formation disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2Fig. S5 from Wilson et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
axoneme assembly disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
eye fused with eye, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions text only from Wilson et al., 2009
cilium or flagellum-dependent cell motility disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
medial floor plate morphology, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S5 from Wilson et al., 2009
somite muscle pioneer absent, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
heart looping disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
heart tube straight, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
Kupffer's vesicle altered number of ciliated cell axonemal microtubule, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3Fig. S11 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
pancreas position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
Kupffer's vesicle axoneme disorganized, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
atrium inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. 2 from Wilson et al., 2009
pancreas inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
gut position, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
liver inverted, abnormal AB + MO1-stk36 + MO4-tp53 standard conditions Fig. S11 from Wilson et al., 2009
nervous system necrotic, abnormal TU + MO1-stk36 standard conditions Fig. 7 with image from Xia et al., 2010
growth delayed, abnormal TU + MO1-stk36 standard conditions Fig. 7 with image from Xia et al., 2010
whole organism wholly dorsalized, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
trunk decreased length, abnormal TU + MO1-stk36 + MO4-tp53 standard conditions Fig. 7 with image from Xia et al., 2010
muscle pioneer absent, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell decreased amount, abnormal gli1ts269/ts269 + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal gli1ts269/ts269 + MO1-stk36 standard conditions Fig. 6 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO1-sufu standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
Citations