Morpholino
MO1-ptch1
- ID
- ZDB-MRPHLNO-050308-3
- Name
- MO1-ptch1
- Previous Names
-
- MO1-ptc2
- ptc2 MO (1)
- Target
- Sequence
-
5' - AGGAGACATTAACAGCCGAGGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch1
No data available
Phenotype
Phenotype resulting from MO1-ptch1
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-ptch1
1 - 5 of 29 Show all
Citations
- Hong, S., Hu, P., Jang, J.H., Carrington, B., Sood, R., Berger, S.I., Roessler, E., Muenke, M. (2020) Functional analysis of Sonic Hedgehog variants associated with holoprosencephaly in humans using a CRISPR/Cas9 zebrafish model. Human Mutation. 41(12):2155-2166
- Nagai-Tanima, M., Hong, S., Hu, P., Carrington, B., Sood, R., Roessler, E., Muenke, M. (2020) Rare hypomorphic human variation in the heptahelical domain of SMO contributes to holoprosencephaly phenotypes. Human Mutation. 41(12):2105-2118
- Kaur, S., Gupta, S., Chaudhary, M., Khursheed, M.A., Mitra, S., Kurup, A.J., Ramachandran, R. (2018) let-7 MicroRNA-Mediated Regulation of Shh Signaling and the Gene Regulatory Network Is Essential for Retina Regeneration. Cell Reports. 23:1409-1423
- Pan, C., Xiong, Y., Lv, X., Xia, Y., Zhang, S., Chen, H., Fan, J., Wu, W., Liu, F., Wu, H., Zhou, Z., Zhang, L., Zhao, Y. (2017) UbcD1 regulates Hedgehog signaling by directly modulating Ci ubiquitination and processing. EMBO reports. 18:1922-1934
- Chassaing, N., Davis, E.E., McKnight, K.L., Niederriter, A.R., Causse, A., David, V., Desmaison, A., Lamarre, S., Vincent-Delorme, C., Pasquier, L., Coubes, C., Lacombe, D., Rossi, M., Dufier, J.L., Dollfus, H., Kaplan, J., Katsanis, N., Etchevers, H.C., Faguer, S., Calvas, P. (2016) Targeted resequencing identifies PTCH1 as a major contributor to ocular developmental anomalies and extends the SOX2 regulatory network. Genome research. 26(4):474-85
- Huang, P., Xiong, F., Megason, S.G., and Schier, A.F. (2012) Attenuation of notch and hedgehog signaling is required for fate specification in the spinal cord. PLoS Genetics. 8(6):e1002762
- Stückemann, T., Wegleiter, T., Stefan, E., Nägele, O., Tarbashevich, K., Böck, G., Raz, E., and Aanstad, P. (2012) Zebrafish Cxcr4a determines the proliferative response to Hedgehog signalling. Development (Cambridge, England). 139(15):2711-2720
- Huang, P., and Schier, A.F. (2009) Dampened Hedgehog signaling but normal Wnt signaling in zebrafish without cilia. Development (Cambridge, England). 136(18):3089-3098
- Ochi, H., Pearson, B.J., Chuang, P.T., Hammerschmidt, M., and Westerfield, M. (2006) Hhip regulates zebrafish muscle development by both sequestering Hedgehog and modulating localization of Smoothened. Developmental Biology. 297(1):127-140
- Woods, I.G., and Talbot, W.S. (2005) The you Gene Encodes an EGF-CUB Protein Essential for Hedgehog Signaling in Zebrafish. PLoS Biology. 3(3):e66
1 - 10 of 11
Show