Morpholino

MO1-ptch1

ID
ZDB-MRPHLNO-050308-3
Name
MO1-ptch1
Previous Names
  • MO1-ptc2
  • ptc2 MO (1)
Target
Sequence
5' - AGGAGACATTAACAGCCGAGGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch1
Expressed Gene Anatomy Figures
gli1 Fig. 5 from Chassaing et al., 2016
ptch1 Fig. 5 from Chassaing et al., 2016
Phenotype
Phenotype resulting from MO1-ptch1
Phenotype Fish Figures
eye decreased size, abnormal WT + MO1-ptch1 Fig. 3 from Chassaing et al., 2016
fast muscle cell increased amount, abnormal WT + MO1-ptch1 Fig. 2 from Wolff et al., 2003
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-ptch1 Fig. 2 from Wolff et al., 2003
slow muscle cell mislocalised, abnormal WT + MO1-ptch1 Fig. 2 from Wolff et al., 2003
somite shape, abnormal WT + MO1-ptch1 Fig. S3 from Chassaing et al., 2016
whole organism gli1 expression increased amount, abnormal WT + MO1-ptch1 Fig. 5 from Chassaing et al., 2016
whole organism ptch1 expression increased amount, abnormal WT + MO1-ptch1 Fig. 5 from Chassaing et al., 2016
Phenotype of all Fish created by or utilizing MO1-ptch1
Phenotype Fish Conditions Figures
somite shape, abnormal WT + MO1-ptch1 standard conditions Fig. S3 from Chassaing et al., 2016
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
whole organism ptch1 expression increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 5 from Chassaing et al., 2016
slow muscle cell mislocalised, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
whole organism gli1 expression increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 5 from Chassaing et al., 2016
eye decreased size, abnormal WT + MO1-ptch1 standard conditions Fig. 3 from Chassaing et al., 2016
fast muscle cell increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
whole organism ptch2 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3,  Fig. 4 with image from Ochi et al., 2006
somite muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
fast muscle cell decreased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3 from Ochi et al., 2006
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3,  Fig. 4 with image from Ochi et al., 2006
whole organism hhip expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
whole organism foxa expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 4 with image from Ochi et al., 2006
whole organism gli1 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
adaxial cell dispersed, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell absent, abnormal smob641/b641 + MO1-ptch1 + MO1-ptch2 (AB) standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
fast muscle cell decreased amount, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer absent, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.