header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050301-3
Morpholino Name: MO1-ascl1a
Target: ascl1a
Previous Name: ash1a MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCTTGGCGGTGATGTCCATTTCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ascl1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ascl1a
Expressed Gene Anatomy Figures
ascl1a Fig. 2 from Ramachandran et al., 2012
insm1a Fig. 2 from Ramachandran et al., 2012
pomca Fig. 1 with image from Pogoda et al., 2006
prl Fig. 1 with image from Pogoda et al., 2006
PHENOTYPE
Phenotype resulting from MO1-ascl1a
Phenotype of all Fish created by or utilizing MO1-ascl1a
Genome Resources:
CITATIONS (15)