Morpholino

MO1-her5

ID

ZDB-MRPHLNO-050224-4

Name

MO1-her5

Previous Names

Target

Sequence

5' - TTGGTTCGCTCATTTTGTGTATTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino targeting her5.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-her5

No data available

Phenotype

Phenotype resulting from MO1-her5

Phenotype	Fish	Figures
endodermal cell fate specification disrupted, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
hepatic duct morphology, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
liver decreased size, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
liver morphology, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
liver development disrupted, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
pancreas morphology, abnormal	WT + MO1-her5	Fig. 6 from Shin et al., 2008
pancreas development disrupted, abnormal	s854Tg + MO1-her5	Fig. 6 from Shin et al., 2008
pancreatic duct morphology, abnormal	s854Tg + MO1-her5	Fig. 6 from Shin et al., 2008

Phenotype of all Fish created by or utilizing MO1-her5

Phenotype	Fish	Conditions	Figures
liver decreased size, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
liver morphology, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
endodermal cell fate specification disrupted, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreas morphology, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
liver development disrupted, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreas development disrupted, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
hepatic duct morphology, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreatic duct morphology, abnormal	WT + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreatic duct morphology, abnormal	s854Tg + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
hepatic duct morphology, abnormal	s854Tg + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008
pancreas development disrupted, abnormal	s854Tg + MO1-her5	standard conditions	Fig. 6 from Shin et al., 2008

Citations