Morpholino

MO7-pax8

ID
ZDB-MRPHLNO-050208-2
Name
MO7-pax8
Previous Names
  • variant 2/3 MO (1)
Target
Sequence
5' - GACCTCGCCCAGTGCTGTTGGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation blocker for splice variants 2 and 3 (variant 2/3 MO). This MO blocks translation of isoforms predicted to include the entire Paired domain.
Reference: Mackereth et al. (2005)
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-pax8
No data available
Phenotype
Phenotype resulting from MO7-pax8
No data available
Phenotype of all Fish created by or utilizing MO7-pax8
Phenotype Fish Conditions Figures
otic vesicle decreased size, abnormal AB + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
otic vesicle has fewer parts of type hair cell, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 3 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image,  Fig. 3 with image from Mackereth et al., 2005
midbrain hindbrain boundary decreased width, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Mackereth et al., 2005
lateral crista physical object quality, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 3 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image,  Fig. 3 with image from Mackereth et al., 2005
otic placode physical object quality, abnormal WT + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal fgf8ati282a/ti282a + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type otolith, abnormal fgf8ati282a/ti282a + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic placode physical object quality, abnormal fgf8ati282a/ti282a + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type hair cell, abnormal fgf8ati282a/ti282a + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal pax2atu29a/tu29a + MO7-pax8 standard conditions Fig. 6 with image from Mackereth et al., 2005
midbrain hindbrain boundary ventro-medial region apoptotic, abnormal pax2atu29a/tu29a + MO7-pax8 standard conditions Fig. 6 with image from Mackereth et al., 2005
whole organism lacks all parts of type facial ganglion, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
otic vesicle decreased size, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type glossopharyngeal ganglion, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type vagal ganglion 2, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type vagal ganglion 1, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
otic vesicle decreased size, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic placode physical object quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-foxi1 + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO1-foxi1 + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type otolith, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type hair cell, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type otolith, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle physical object quality, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
whole organism lacks all parts of type otic vesicle, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
otic vesicle development decreased process quality, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 5 with image from Mackereth et al., 2005
epibranchial ganglion decreased amount, abnormal pax2atu29a/tu29a + MO1-pax2b + MO6-pax8 + MO7-pax8 standard conditions Fig. 3 with image from Padanad et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.