Morpholino

MO1-twsg1b

ID
ZDB-MRPHLNO-050119-5
Name
MO1-twsg1b
Previous Names
  • MO1 (1)
  • MO1-tsgb (1)
  • tsg1-MO (1)
Target
Sequence
5' - CTGATGATGATGATGAAGACCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-twsg1b
No data available
Phenotype
Phenotype resulting from MO1-twsg1b
Phenotype of all Fish created by or utilizing MO1-twsg1b
Phenotype Fish Conditions Figures
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1Fig. 2 from Esser et al., 2018
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
Citations