Morpholino

MO1-dact1

ID

ZDB-MRPHLNO-041217-1

Name

MO1-dact1

Previous Names

dpr1MO (1)

Target

dact1 (1)

Sequence

5' - AACAAATACTAACCAGAGCTTGGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dact1

No data available

Phenotype

Phenotype resulting from MO1-dact1

Phenotype	Fish	Figures
diencephalon decreased size, abnormal	WT + MO1-dact1	Fig. 3 from Waxman et al., 2004
midbrain decreased size, abnormal	WT + MO1-dact1	Fig. 3 from Waxman et al., 2004
telencephalon increased size, abnormal	WT + MO1-dact1	Fig. 4 from Waxman et al., 2004
whole organism decreased size, abnormal	WT + MO1-dact1	Fig. 3 from Waxman et al., 2004

Phenotype of all Fish created by or utilizing MO1-dact1

Phenotype	Fish	Conditions	Figures
midbrain decreased size, abnormal	WT + MO1-dact1	standard conditions	Fig. 3 from Waxman et al., 2004
telencephalon increased size, abnormal	WT + MO1-dact1	standard conditions	Fig. 4 from Waxman et al., 2004
whole organism decreased size, abnormal	WT + MO1-dact1	standard conditions	Fig. 3 from Waxman et al., 2004
diencephalon decreased size, abnormal	WT + MO1-dact1	standard conditions	Fig. 3 from Waxman et al., 2004
whole organism decreased length, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
diencephalon decreased size, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
midbrain decreased size, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
somite increased width, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
notochord increased width, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
whole organism decreased size, abnormal	WT + MO1-dact1 + MO1-dact2	standard conditions	Fig. 3 from Waxman et al., 2004
head decreased size, abnormal	WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a	standard conditions	Fig. 4 from Waxman et al., 2004
telencephalon increased size, abnormal	WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a	standard conditions	Fig. 4 from Waxman et al., 2004
post-vent region decreased size, abnormal	WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a	standard conditions	Fig. 4 from Waxman et al., 2004
whole organism wholly anteriorized, abnormal	WT + MO1-dact1 + MO1-wnt8a + MO2-wnt8a	standard conditions	Fig. 4 from Waxman et al., 2004

Citations