Morpholino

MO1-ihhb

ID
ZDB-MRPHLNO-041129-3
Name
MO1-ihhb
Previous Names
  • ehh-MO (1)
  • ehh-MO-1
  • MO1-ehh (1)
Target
Sequence
5' - GAGGAGCGCCGCCGCCGTGGAGAGTCTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino targeting ehh.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ihhb
Phenotype
Phenotype resulting from MO1-ihhb
Phenotype of all Fish created by or utilizing MO1-ihhb
Phenotype Fish Conditions Figures
spinal cord regulation of oligodendrocyte progenitor proliferation disrupted, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord neuron increased amount, abnormal WT + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal ck1Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
glioblast (sensu Vertebrata) cell division increased occurrence, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord spinal cord oligodendrocyte cell fate specification disrupted, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
primary motor neuron decreased amount, abnormal shhaDf(Chr07)t4/t4 + MO1-ihhb + MO1-shhb(AB) standard conditions Fig. 2 with image from Lewis et al., 2001
positive regulation of transcription, DNA-templated disrupted, abnormal shhaDf(Chr07)t4/t4 + MO1-ihhb + MO2-shhb standard conditions Fig. 6 with image from Cheesman et al., 2004
positive regulation of transcription, DNA-templated arrested, abnormal smob641/b641 + MO1-ihhb + MO2-shhb(AB) standard conditions Fig. 6 with image from Cheesman et al., 2004
Citations