ZFIN ID: ZDB-MRPHLNO-041116-2
Morpholino Name: MO1-pax6b
Target: pax6b (1)
Previous Name: mo-1-pax6b (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGAGCCCTTCCGAGCAAAACAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pax6b
Expressed Gene Anatomy Figures
egr2b Fig. 7 from Nolte et al., 2006
en2b Fig. 7 from Nolte et al., 2006
hoxd4a Fig. 7 from Nolte et al., 2006
PHENOTYPE
Phenotype resulting from MO1-pax6b
Phenotype of all Fish created by or utilizing MO1-pax6b
Genome Resources:
CITATIONS (5)