ZFIN ID: ZDB-MRPHLNO-041109-3
Morpholino Name: MO3-fgf3
Target: fgf3 (2)
Previous Name: fgf3C-MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTCGCTGGAATAGAAAGAGCTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-fgf3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-fgf3 No data available
PHENOTYPE
Phenotype resulting from MO3-fgf3
No data available

Phenotype of all Fish created by or utilizing MO3-fgf3
Phenotype Fish Conditions Figures
mesoderm anterior region has2 expression absent, abnormal fgf8ati282a/ti282a + MO2-fgf3 + MO3-fgf3 control Fig. 7 with image from McCarthy et al., 2016
chondroblast sox9a expression absent, abnormal fgf8ati282a/ti282a + MO2-fgf3 + MO3-fgf3 control Fig. 5 with image from McCarthy et al., 2016
chondrocyte col2a1a expression absent, abnormal fgf8ati282a/ti282a + MO2-fgf3 + MO3-fgf3 control Fig. 5 with image from McCarthy et al., 2016
OTHER MO3-fgf3 MORPHOLINO PAGESNo links to external sites
CITATIONS (7)