header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041109-2
Morpholino Name: MO2-fgf3
Target: fgf3 (2)
Previous Names: fgf3-MO#2, fgf3B-MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTCCCATCAAAGAAGTATCATTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fgf3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fgf3 No data available
PHENOTYPE
Phenotype resulting from MO2-fgf3
No data available

Phenotype of all Fish created by or utilizing MO2-fgf3
OTHER MO2-fgf3 MORPHOLINO PAGESNo links to external sites
CITATIONS (9)