Image
Figure Caption
Fig. S3
furinA and furinB MOs specifically and efficiently block splicing. RT-PCR was performed on RNA isolated from 24 and 48 hpf zebrafish embryos injected with 16 ng furinA MO or 10 ng of furinB MO at 1–4 cell stage. These MOs are designed to exon 9 splice sites. The following gene-specific PCR primers were used: furinA, 5′GTGGATGGGCCTGCAAAAT3′/5′CTTTGCTAAGGCTACAATG3′& and furinB, 5′TCTAAGCTTGAACTCCCAGC3′/5′CTGGGCCAAAGCGACCATTG3′. Arrowheads indicate wild-type splice products, and asterisks indicate an MO-induced splice variant with deletion of exon 9.
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and
ZFIN has permission only to display this image to its users.
Additional permissions should be obtained from the applicable author or publisher of the image.
Reprinted from Developmental Biology, 295(1), Walker, M.B., Miller, C.T., Talbot, J.C., Stock, D.W., and Kimmel, C.B., Zebrafish furin mutants reveal intricacies in regulating Endothelin1 signaling in craniofacial patterning, 194-205, Copyright (2006) with permission from Elsevier. Full text @ Dev. Biol.