FIGURE

Figure 2

ID
ZDB-FIG-220131-312
Publication
Gong et al., 2021 - Establishment of a Dihydrofolate Reductase Gene Knock-In Zebrafish Strain to Aid Preliminary Analysis of Congenital Heart Disease Mechanisms
Other Figures
All Figure Page
Back to All Figure Page
Figure 2

Design of guide RNA and identification primer. (A) Guide #5 TGATGCAATGGTCAGAGATGTGG; (B) the sequencing result of the activity verification; (C) the optimized amino acid sequence alignment (the lowercase font is the optimized base).

Expression Data

Expression Detail
Antibody Labeling
Phenotype Data

Phenotype Detail
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Front Cardiovasc Med