Fig. 4-S1
- ID
- ZDB-FIG-181025-8
- Publication
- Row et al., 2018 - BMP and FGF signaling interact to pattern mesoderm by controlling basic helix-loop-helix transcription factor activity
- Other Figures
- All Figure Page
- Back to All Figure Page
BMP signaling is necessary and sufficient for id1 and id3 expression. HS:dnbmpr and HS:caalk6 transgenic lines were used to inhibit or activate BMP signaling, respectively, at the 12-somite stage and embryos were fixed 3 hr later. id1 and id3 are normally expressed in the tailbud and areas of vasculogenesis, as well as other regions of the body (A, A?, D, D?). Loss of BMP signaling results in a near total loss of expression of both id1 (B, B?) and id3 (E, E?) throughout the body. Activation of BMP signaling has the opposite result, with a broad expansion of id1 (C, C?) and id3 (F, F?) throughout the body. The analysis was repeated to perform an unbiased blind assessment of expression changes in the different genetic backgrounds. Embryos from HS:dnbmpr and HS:caalk6 outcrosses were heat-shocked at the 12-somite stage and fixed three hours later. Embryos were mixed together and in situ hybridization was performed for id1 or id3. Embryos were sorted based on expression patterns (strong, medium, or weak) and PCR genotyped using primers specific for the HS:caalk6 or HS:dnbmpr transgenes. Strong expression correlated with presence of the HS:caalk6 transgene, weak expression with the presence of the HS:dnbmpr transgene, and medium expression with the absence of both transgenes. The correlation held for 14/15 genotyped id1 stained embryos (5/5 strong, 5/5 medium, 4/5 weak) and 13/16 id3 stained embryos (4/5 strong, 4/5 medium, 5/6 weak). Primers for the HS:dnbmpr transgene amplified the Xenopus laevis BMP receptor within the transgene (forward primer: 5? ATTCATGCCCAAGGACAGGA 3?, reverse primer: 5? CTCCATCTGCGATCTTTGGC 3?, amplicon size is 382 bp), while primers for the HS:caalk6 transgene amplified the kikume sequence within the transgene (forward primer: 5? GTAAACGGGCACAAGTTCGT 3?, reverse primer: 5? CAGCCCGGAATGAGCTTTAG 3?, amplicon size is 615 bp). |