FIGURE

Fig. 3

ID

ZDB-FIG-140224-35

Publication

Shen et al., 2002 - Cloning, expression, and alternative splicing of neogenin1 in zebrafish

Other Figures

All Figure Page

Back to All Figure Page

Fig. 3

Expression of zneo1 splice variants in zebrafish. (a) Schematic representation of RT-PCRs used for alternative splicing study. RT-PCR was performed with the indicated primers: znsp1, TCACGCACAGACCATCAAAG; znsp1′, TGGTCTTCCAACGCACTGTA; znsp2, CTGTAGTGAGCAAAGAGG; znsp2′, AGGTCTGGTGGTTTGAGA; znsp3, GGGCAACTCCAAAGATCTCAA; znsp3′, TGAAAGGTCAGTGGTGCAAGA under standard conditions. The resulting products derived from the first strand cDNAs of various adult tissues and staged embryos were subsequently cloned and sequenced. The possible splice isoforms are illustrated in the figure and named after the region amplified and the presence or absence of the alternative splices. FN4-FN6, fibronectin type III domains 4-6; hpf, hours post-fertilization; sp1-sp4, alternative splice 1-4 (indicated by dotted lines); TM, transmembrane domain. (b) Expression of zneo1 splice variants in adult and embryonic zebrafish.

Expression Data

Gene:	neo1a
Fish:	WT
Anatomical Terms:	brain gill heart intestine kidney liver oocyte skeletal muscle testis whole organism
Stage Range:	5-9 somites to Adult

Expression Detail

Antibody Labeling

Phenotype Data

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image.

Reprinted from Mechanisms of Development, 118(1-2), Shen, H., Illges, H., Reuter, A., and Stürmer, C., Cloning, expression, and alternative splicing of neogenin1 in zebrafish, 219-223, Copyright (2002) with permission from Elsevier. Full text @ Mech. Dev.