CRISPR

CRISPR1-adgrl2b.1

ID
ZDB-CRISPR-260720-1
Name
CRISPR1-adgrl2b.1
Previous Names
None
Target
Sequence
5' - GGCGGAGCGTTTATCATAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-adgrl2b.1
No data available
Phenotype
Phenotype resulting from CRISPR1-adgrl2b.1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-adgrl2b.1
Phenotype Fish Conditions Figures
dorsal aorta blood vessel endothelial cell decreased size, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 4 with image from Tanaka et al., 2024
dorsal aorta blood vessel endothelial cell circular, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 4 with image from Tanaka et al., 2024
dorsal aorta vascular endothelium ab2-tjp1 labeling spatial pattern, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 4 with image from Tanaka et al., 2024
dorsal aorta blood vessel endothelial cell decreased size, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 4 with image from Tanaka et al., 2024
dorsal aorta blood vessel endothelial cell circular, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 4 with image from Tanaka et al., 2024
dorsal aorta vascular endothelium ab2-tjp1 labeling spatial pattern, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 4 with image from Tanaka et al., 2024
heart contraction decreased occurrence, abnormal s896Tg/s896Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 4 with image from Tanaka et al., 2024
intersegmental vessel decreased diameter, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 6 with image from Tanaka et al., 2024
intersegmental vessel mCherry expression spatial pattern, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 6 with image from Tanaka et al., 2024
intersegmental artery decreased diameter, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 6 with image from Tanaka et al., 2024
intersegmental artery mCherry expression spatial pattern, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 standard conditions Fig. 6 with image from Tanaka et al., 2024
intersegmental vessel decreased diameter, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 6 with image from Tanaka et al., 2024
intersegmental vessel mCherry expression spatial pattern, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 6 with image from Tanaka et al., 2024
heart contraction decreased occurrence, abnormal s896Tg/s896Tg; y7Tg/y7Tg + CRISPR10-adgrl2a + CRISPR1-adgrl2b.1 + MO1-tnnt2a standard conditions Fig. 6 with image from Tanaka et al., 2024
Citations