CRISPR

CRISPR4-pikfyve

ID
ZDB-CRISPR-260514-3
Name
CRISPR4-pikfyve
Previous Names
None
Target
Sequence
5' - TGTGATGTACGTAAAGTAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR4-pikfyve
No data available
Phenotype
Phenotype resulting from CRISPR4-pikfyve
No data available
Phenotype of all Fish created by or utilizing CRISPR4-pikfyve
Phenotype Fish Conditions Figures
retinal pigmented epithelium increased thickness, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 3 with image from Attia et al., 2026
retina vacuole increased amount, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 2 with image from Attia et al., 2026
pericardium edematous, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 2 with image from Attia et al., 2026
retinal pigmented epithelium increased thickness, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve chemical treatment by environment: apilimod Fig. 5 with image from Attia et al., 2026
visual perception absent process, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 4 with image from Attia et al., 2026
retinal pigmented epithelium melanosome fragmented, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 9 with image from Attia et al., 2026
retina apoptotic process increased process quality, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 8 with image from Attia et al., 2026
visual perception decreased process quality, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve chemical treatment by environment: apilimod Fig. 6 with image from Attia et al., 2026
photoreceptor inner segment layer vacuole increased area, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 3 with image from Attia et al., 2026
retinal pigmented epithelium detached from retinal outer nuclear layer, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 2 with image from Attia et al., 2026
retinal pigmented epithelium melanosome swollen, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 9 with image from Attia et al., 2026
retinal pigmented epithelium phagocytic vesicle increased amount, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve chemical treatment by environment: apilimod Fig. 5 with image from Attia et al., 2026
whole organism decreased length, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 2 with image from Attia et al., 2026
retinal pigmented epithelium phagocytic vesicle increased area, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve chemical treatment by environment: apilimod Fig. 5 with image from Attia et al., 2026
photoreceptor inner segment layer vacuole increased area, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve chemical treatment by environment: apilimod Fig. 5 with image from Attia et al., 2026
retinal pigmented epithelium vacuole increased amount, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 3 with image from Attia et al., 2026
retina photoreceptor outer segment decreased length, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 4 with image from Attia et al., 2026
eye decreased diameter, abnormal WT + CRISPR3-pikfyve + CRISPR4-pikfyve control Fig. 2 with image from Attia et al., 2026
Citations