CRISPR

CRISPR2-crip2

ID

ZDB-CRISPR-260422-10

Name

CRISPR2-crip2

Previous Names

None

Target

crip2 (1)

Sequence

5' - GGGCTGCAGTAAGACCCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fcu2	crip2

Expression

Gene expression in Wild Types + CRISPR2-crip2

No data available

Phenotype

Phenotype resulting from CRISPR2-crip2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-crip2

Phenotype	Fish	Conditions	Figures
artery efnb2a expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 4. from Aleman et al., 2026
whole organism crip3 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 1. from Aleman et al., 2026
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 2. from Aleman et al., 2026
ventral wall of dorsal aorta notch1b expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 5. from Aleman et al., 2026
dorsal aorta crip2 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 1. from Aleman et al., 2026
endothelial cell cdh5 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 4. from Aleman et al., 2026
thymus rag1 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 2. from Aleman et al., 2026
dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 6. from Aleman et al., 2026
ventral wall of dorsal aorta dll4 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 5. from Aleman et al., 2026
dorsal aorta hematopoietic multipotent progenitor cell myb expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3	chemical treatment by environment: phenethyl caffeate	Fig. 7. from Aleman et al., 2026
endothelial cell fli1 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 4. from Aleman et al., 2026
vasculature crip2 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 1. from Aleman et al., 2026
whole organism crip2 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 1. from Aleman et al., 2026
somite posterior side crip2 expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 1. from Aleman et al., 2026
dorsal aorta hematopoietic multipotent progenitor cell myb expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3	chemical treatment by environment: dibenzoazepine	Fig. 6. from Aleman et al., 2026
dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 7. from Aleman et al., 2026
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3	standard conditions	Fig. 2. , Fig. 3. from Aleman et al., 2026
dorsal aorta mCherry expression spatial pattern, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; la2Tg/la2Tg; y206Tg/y206Tg	standard conditions	Fig. 2. from Aleman et al., 2026
dorsal aorta mCherry expression decreased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; la2Tg/la2Tg; y206Tg/y206Tg	standard conditions	Fig. 2. from Aleman et al., 2026
dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased distribution, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; la2Tg/la2Tg; y206Tg/y206Tg	standard conditions	Fig. 2. from Aleman et al., 2026
ventral wall of dorsal aorta EGFP expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: dibenzoazepine	Fig. 6. from Aleman et al., 2026
ventral wall of dorsal aorta endothelial to hematopoietic transition increased occurrence, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: phenethyl caffeate	Fig. 7. from Aleman et al., 2026
ventral wall of dorsal aorta mCherry expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: dibenzoazepine	Fig. 6. from Aleman et al., 2026
ventral wall of dorsal aorta EGFP expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: phenethyl caffeate	Fig. 7. from Aleman et al., 2026
ventral wall of dorsal aorta endothelial to hematopoietic transition increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	standard conditions	Fig. 6. , Fig. 7. from Aleman et al., 2026
ventral wall of dorsal aorta EGFP expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	standard conditions	Fig. 6. , Fig. 7. from Aleman et al., 2026
ventral wall of dorsal aorta mCherry expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	standard conditions	Fig. 6. , Fig. 7. from Aleman et al., 2026
ventral wall of dorsal aorta endothelial to hematopoietic transition increased occurrence, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: dibenzoazepine	Fig. 6. from Aleman et al., 2026
ventral wall of dorsal aorta mCherry expression amount, ameliorated	crip2^fcu2/fcu2; crip3^fcu3/fcu3; um14Tg/um14Tg; y206Tg/y206Tg	chemical treatment by environment: phenethyl caffeate	Fig. 7. from Aleman et al., 2026
artery dll4 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
artery hey2 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
arterial endothelial cell differentiation increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
vein flt4 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
blood vessel morphogenesis increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
blood vessel endothelial cell regulation of cell cycle increased rate, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
artery flt1 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
blood vessel endothelial cell proliferation involved in sprouting angiogenesis increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
artery efnb2a expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
venous endothelial cell differentiation increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
artery notch1b expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
vein dab2 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
apoptotic process involved in blood vessel morphogenesis increased occurrence, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
vein stab2 expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026
vein mrc1a expression increased amount, abnormal	crip2^fcu2/fcu2; crip3^fcu3/fcu3; y206Tg/y206Tg	standard conditions	Fig. 5. from Aleman et al., 2026

Citations