CRISPR

CRISPR1-lrrtm4l1

ID
ZDB-CRISPR-260320-1
Name
CRISPR1-lrrtm4l1
Previous Names
None
Target
Sequence
5' - GGAAGGCAGACGACTCACAGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uol3 lrrtm4l1
Expression
Gene expression in Wild Types + CRISPR1-lrrtm4l1
No data available
Phenotype
Phenotype resulting from CRISPR1-lrrtm4l1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-lrrtm4l1
Phenotype Fish Conditions Figures
brain sypa expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
aggressive behavior process quality, abnormal lrrtm4l1uol3/uol3 (AB) housing conditions Fig. 2 with image from Hillman et al., 2025
brain gpc2 expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain cyfip2 expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain tdo2a expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
territorial aggressive behavior decreased process quality, abnormal lrrtm4l1uol3/uol3 (AB) control Fig. 1 with image from Hillman et al., 2025
brain gria2a expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain kcnk5b expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain kmo expression increased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
social behavior process quality, abnormal lrrtm4l1uol3/uol3 (AB) housing conditions Fig. 2 with image from Hillman et al., 2025
brain kcnq5b expression increased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain sema3fb expression increased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
aggressive behavior process quality, abnormal lrrtm4l1uol3/uol3 (AB) housing conditions Fig. 2 with image from Hillman et al., 2025
social behavior increased process quality, abnormal lrrtm4l1uol3/uol3 (AB) control Fig. 1 with image from Hillman et al., 2025
brain kcnc1a expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
whole organism increased length, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. S3 from Hillman et al., 2025
brain grm2b expression increased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
brain vat1 expression decreased amount, abnormal lrrtm4l1uol3/uol3 (AB) standard conditions Fig. 3 with image from Hillman et al., 2025
social behavior process quality, abnormal lrrtm4l1uol3/uol3 (AB) housing conditions Fig. 2 with image from Hillman et al., 2025
Citations