CRISPR

CRISPR2-axin2

ID
ZDB-CRISPR-260210-1
Name
CRISPR2-axin2
Previous Names
None
Target
Sequence
5' - CGGACTCCCCTCTTGCCCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
km28 axin2
Expression
Gene expression in Wild Types + CRISPR2-axin2
No data available
Phenotype
Phenotype resulting from CRISPR2-axin2
No data available
Phenotype of all Fish created by or utilizing CRISPR2-axin2
Phenotype Fish Conditions Figures
pharyngeal arch col1a1a expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
dentine absence of anatomical entity, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
dentine calcium ion decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
dentine carbon atom decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
dentine decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
dentine oxygen atom decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
pharyngeal arch scpp5 expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
odontoblast actin-based cell projection decreased length, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
pharyngeal arch axin2 expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 1 from Song et al., 2025
pericardium edematous, abnormal axin2km28/km28 (AB) standard conditions Fig. 1 from Song et al., 2025
pharyngeal arch sp7 expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
pharyngeal arch runx2b expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
pharyngeal arch smad4a expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
pharyngeal arch vim expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
pharyngeal arch col1a1b expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
odontoblast actin-based cell projection decreased thickness, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
whole organism decreased length, abnormal axin2km28/km28 (AB) standard conditions Fig. 1 from Song et al., 2025
dentine phosphorus atom decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 4 from Song et al., 2025
pharyngeal arch runx2a expression decreased amount, abnormal axin2km28/km28 (AB) standard conditions Fig. 5 from Song et al., 2025
whole organism decreased length, abnormal axin2km28/+ (AB) standard conditions Fig. 1 from Song et al., 2025
tooth 2V young, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 3 from Song et al., 2025
tooth 2V dentin mineralization decreased process quality, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 3 from Song et al., 2025
tooth 3V dental papilla ab1-ctnnb labeling increased distribution, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 2 from Song et al., 2025
tooth 4V nucleus ab1-ctnnb labeling increased distribution, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 2 from Song et al., 2025
tooth 4V dental papilla ab1-ctnnb labeling increased distribution, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 2 from Song et al., 2025
tooth 1V tooth placode absence of anatomical entity, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 3 from Song et al., 2025
tooth 1V tooth placode present, abnormal axin2km28/km28; nc1Tg (AB) standard conditions Fig. 3 from Song et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.