CRISPR

CRISPR1-scamp5a

ID
ZDB-CRISPR-260105-3
Name
CRISPR1-scamp5a
Previous Names
None
Target
Sequence
5' - GGCTGTCTAGCATGGATGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu302 scamp5a
Expression
Gene expression in Wild Types + CRISPR1-scamp5a
No data available
Phenotype
Phenotype resulting from CRISPR1-scamp5a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-scamp5a
Phenotype Fish Conditions Figures
brain dopaminergic neuron th expression spatial pattern, ameliorated scamp5ahzu302/hzu302 (AB) chemical treatment by environment: anthra[1,9-cd]pyrazol-6(2H)-one Fig. 8 with image from Liu et al., 2025
brain rac3b expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain dopaminergic neuron th expression decreased distribution, abnormal scamp5ahzu302/hzu302 (AB) control Fig. 6 with imageFig. 8 with image from Liu et al., 2025
brain Ab3-bad labeling increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
swimming behavior process quality, ameliorated scamp5ahzu302/hzu302 (AB) altered light dark cycle, chemical treatment by environment: L-dopa Fig. 5 with image from Liu et al., 2025
brain jund expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain bcl2b expression decreased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain Ab8-bcl2 labeling decreased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain mapk8ip2 expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain rac3a expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain mapk10 expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain th expression decreased amount, abnormal scamp5ahzu302/hzu302 (AB) control Fig. 6 with imageFig. 8 with image from Liu et al., 2025
brain th expression amount, ameliorated scamp5ahzu302/hzu302 (AB) chemical treatment by environment: anthra[1,9-cd]pyrazol-6(2H)-one Fig. 8 with image from Liu et al., 2025
brain bada expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain casp3b expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
whole organism decreased length, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 4 with image from Liu et al., 2025
brain dopamine decreased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 5 with image from Liu et al., 2025
brain apoptotic process increased process quality, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain Ab29-casp3 labeling increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain atf4b expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
whole organism viability, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 4 with image from Liu et al., 2025
swimming behavior process quality, ameliorated scamp5ahzu302/hzu302 (AB) altered light dark cycle, chemical treatment by environment: pramipexole Fig. 5 with image from Liu et al., 2025
thigmotaxis decreased process quality, abnormal scamp5ahzu302/hzu302 (AB) control Fig. 5 with image from Liu et al., 2025
swimming behavior decreased process quality, abnormal scamp5ahzu302/hzu302 (AB) altered light dark cycle Fig. 5 with image from Liu et al., 2025
brain fosab expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain jun expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 7 with image from Liu et al., 2025
brain casp8 expression increased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
whole organism dead, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 4 with image from Liu et al., 2025
brain bcl2a expression decreased amount, abnormal scamp5ahzu302/hzu302 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
Citations