CRISPR

CRISPR6-cyp1a

ID

ZDB-CRISPR-251022-1

Name

CRISPR6-cyp1a

Previous Names

None

Target

cyp1a (1)

Sequence

5' - CAGGAAAACTGGCCAGCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4180Tg	cyp1a

Expression

Gene expression in Wild Types + CRISPR6-cyp1a

No data available

Phenotype

Phenotype resulting from CRISPR6-cyp1a

No data available

Phenotype of all Fish created by or utilizing CRISPR6-cyp1a

Phenotype	Fish	Conditions	Figures
whole organism ahrrb expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 6 from Xie et al., 2023
whole organism cyp1c2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism cyp1c1 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 5 from Xie et al., 2023
whole organism cyp1a expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism ahrrb expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 6 from Xie et al., 2023
whole organism ahr2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 6 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: tetraphene	Fig. 3 from Xie et al., 2023
whole organism cyp1b1 expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 5 from Xie et al., 2023
whole organism cyp1a expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 5 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: tetraphene	Fig. 3 from Xie et al., 2023
whole organism cyp1c2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 5 from Xie et al., 2023
whole organism cyp1a expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism cyp1c1 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 5 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism cyp1c2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism cyp1b1 expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 5 from Xie et al., 2023
whole organism cyp1b1 expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism cyp1a expression decreased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 2 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism cyp1a expression decreased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	control	Fig. 2, Fig. 5 from Xie et al., 2023
whole organism cyp1a expression decreased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 2 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism ahrrb expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 6 from Xie et al., 2023
whole organism cyp1a expression decreased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 2 from Xie et al., 2023
whole organism cyp1c1 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism dead, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism viability, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 3, Fig. 4 from Xie et al., 2023
whole organism cyp1b1 expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 5 from Xie et al., 2023
whole organism ahrrb expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: dibenz[a,h]anthracene	Fig. 6 from Xie et al., 2023
whole organism cyp1c2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 5 from Xie et al., 2023
whole organism cyp1b1 expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Benzo[k]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism cyp1c2 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 5 from Xie et al., 2023
whole organism cyp1c1 expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 5 from Xie et al., 2023
whole organism cyp1a expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: Indeno[1,2,3-cd]pyrene	Fig. 5 from Xie et al., 2023
whole organism ahrrb expression increased amount, abnormal	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[b]fluoranthene	Fig. 6 from Xie et al., 2023
whole organism cyp1a expression amount, ameliorated	cyp1a^{zf4180Tg/zf4180Tg} (AB)	chemical treatment by environment: benzo[a]pyrene	Fig. 5 from Xie et al., 2023

Citations