CRISPR

CRISPR6-lmx1bb

ID
ZDB-CRISPR-251008-2
Name
CRISPR6-lmx1bb
Previous Names
None
Target
Sequence
5' - GATGGCACTCCGTCCCTGAAGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bsl2816 lmx1bb
Expression
Gene expression in Wild Types + CRISPR6-lmx1bb
No data available
Phenotype
Phenotype resulting from CRISPR6-lmx1bb
No data available
Phenotype of all Fish created by or utilizing CRISPR6-lmx1bb
Phenotype Fish Conditions Figures
whole organism dead, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
glomerular basement membrane absence of anatomical entity, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
whole organism viability, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
swim bladder uninflated, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
podocyte mitochondrion swollen, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
eye edematous, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
glomerular basement membrane podocyte incomplete structure, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
podocyte mitochondrion circular, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
pericardium edematous, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with imageFig. 2. with image from Moss et al., 2025
yolk edematous, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 2. with image from Moss et al., 2025
whole organism decreased length, abnormal lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
whole organism dead, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
post-vent region truncated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
notochord decreased width, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
somite decreased area, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
notochord outer sheath cell increased size, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
pericardium edematous, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
notochord outer sheath cell increased thickness, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
somite skeletal muscle cell decreased area, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
swim bladder uninflated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
skeletal muscle cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
notochord outer sheath cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord inner cell decreased size, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord inner cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord inner cell uninflated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
skeletal muscle cell structurally discontinuous, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
whole organism decreased length, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
Citations