CRISPR

CRISPR4-lmx1ba

ID
ZDB-CRISPR-251008-1
Name
CRISPR4-lmx1ba
Previous Names
None
Target
Sequence
5' - CGGTTTGGACGAGACCTCGAAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bsl2962 lmx1ba
Expression
Gene expression in Wild Types + CRISPR4-lmx1ba
No data available
Phenotype
Phenotype resulting from CRISPR4-lmx1ba
No data available
Phenotype of all Fish created by or utilizing CRISPR4-lmx1ba
Phenotype Fish Conditions Figures
Meckel's cartilage decreased length, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
ventral mandibular arch cell population proliferation decreased process quality, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
chondrocyte vesicle increased amount, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
ventral mandibular arch decreased length, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
whole organism decreased length, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
chondrocyte disorganized, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
cartilaginous joint cell population proliferation decreased process quality, abnormal lmx1babsl2962/bsl2962 (EKW, TL) standard conditions Fig. 3. with image from Moss et al., 2025
whole organism dead, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
post-vent region truncated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
skeletal muscle cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
notochord outer sheath cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord inner cell decreased size, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord decreased width, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
somite decreased area, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
notochord outer sheath cell increased size, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
notochord inner cell disorganized, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
pericardium edematous, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
notochord inner cell uninflated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
skeletal muscle cell structurally discontinuous, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
notochord outer sheath cell increased thickness, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 5. with image from Moss et al., 2025
whole organism decreased length, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
somite skeletal muscle cell decreased area, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 4. with image from Moss et al., 2025
swim bladder uninflated, abnormal lmx1babsl2962/bsl2962; lmx1bbbsl2816/bsl2816 (EKW, TL) standard conditions Fig. 1. with image from Moss et al., 2025
Citations