CRISPR

CRISPR3-sdhb

ID
ZDB-CRISPR-251002-3
Name
CRISPR3-sdhb
Previous Names
None
Target
Sequence
5' - CAGCGTGTGTTGTGCTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-sdhb
No data available
Phenotype
Phenotype resulting from CRISPR3-sdhb
No data available
Phenotype of all Fish created by or utilizing CRISPR3-sdhb
Phenotype Fish Conditions Figures
whole organism dihydroxyacetone phosphate decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism fkbp5 expression increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 4 with image from Parisien-La Salle et al., 2025
heart contraction increased frequency, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 1 with image from Parisien-La Salle et al., 2025
whole organism decreased life span, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 1 with image from Parisien-La Salle et al., 2025
whole organism pfkfb4b expression increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 4 with image from Parisien-La Salle et al., 2025
whole organism noradrenaline increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism (R)-adrenaline increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism leucine increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism dead, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 1 with image from Parisien-La Salle et al., 2025
swimming decreased occurrence, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 1 with image from Parisien-La Salle et al., 2025
whole organism GTP increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism lactate increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism hif1al expression increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 4 with image from Parisien-La Salle et al., 2025
whole organism Normetanephrine increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism arginine increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism Metanephrine increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism NADH decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism sdhb expression decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 1 with image from Parisien-La Salle et al., 2025
whole organism glutathione disulfide decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism sn-glycerol 3-phosphate increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism ATP increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism dopamine increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism citrate salt increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism succinate increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
norepinephrine secretion increased occurrence, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
whole organism isocitric acid increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism aspartate decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism angptl4 expression increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 4 with image from Parisien-La Salle et al., 2025
whole organism glutamic acid decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism NAD increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism adenosine decreased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
whole organism acetyl-CoA increased amount, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 3 with image from Parisien-La Salle et al., 2025
hormone secretion increased occurrence, abnormal WT + CRISPR2-sdhb + CRISPR3-sdhb + CRISPR4-sdhb standard conditions Fig. 2 with image from Parisien-La Salle et al., 2025
Citations