CRISPR

CRISPR1-creb3l3b

ID

ZDB-CRISPR-250924-7

Name

CRISPR1-creb3l3b

Previous Names

None

Target

creb3l3b (1)

Sequence

5' - GGAGAGCCGCAAGAAAAAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
c803	creb3l3b

Expression

Gene expression in Wild Types + CRISPR1-creb3l3b

No data available

Phenotype

Phenotype resulting from CRISPR1-creb3l3b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-creb3l3b

Phenotype	Fish	Conditions	Figures
intestine apoa4b.1 expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoeb expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoa4a expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoa4b.2 expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoea expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoa4b.3 expression increased amount, abnormal	creb3l3a^c802/+; creb3l3b^c803/+ (AB)	high fat	Fig. 4 from Sweeney et al., 2025
whole organism low-density lipoprotein particle decreased amount, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 5 , Fig. 6 from Sweeney et al., 2025
intestine apoa4a expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025
yolk lipid increased amount, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 3 from Sweeney et al., 2025
intestine apoeb expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025
regulation of plasma lipoprotein particle levels disrupted, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 6 from Sweeney et al., 2025
whole organism intermediate-density lipoprotein particle increased amount, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 5 from Sweeney et al., 2025
intestine apoa4b.2 expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoa4b.3 expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025
intestine apoa4b.1 expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025
yolk opaque, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 3 from Sweeney et al., 2025
intestine opaque, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 3 from Sweeney et al., 2025
enterocyte lipid droplet increased size, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 3 from Sweeney et al., 2025
whole organism intermediate-density lipoprotein particle decreased amount, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 5 from Sweeney et al., 2025
plasma lipoprotein particle clearance disrupted, abnormal	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	standard conditions	Fig. 6 from Sweeney et al., 2025
intestine apoea expression amount, ameliorated	creb3l3a^c802/c802; creb3l3b^c803/c803 (AB)	high fat	Fig. 4 from Sweeney et al., 2025

Citations