CRISPR

CRISPR20-zbtb16a

ID
ZDB-CRISPR-250911-8
Name
CRISPR20-zbtb16a
Previous Names
None
Target
Sequence
5' - TCCTAGACAGTCTGCGCCTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR20-zbtb16a
No data available
Phenotype
Phenotype resulting from CRISPR20-zbtb16a
No data available
Phenotype of all Fish created by or utilizing CRISPR20-zbtb16a
Phenotype Fish Conditions Figures
whole organism cxcl8a expression decreased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
whole organism tsc22d3 expression amount, ameliorated AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
whole organism glucose increased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
whole organism fkbp5 expression increased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
whole organism pparg expression decreased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b control Figure 4 with image from Galuh et al., 2025
whole organism pparg expression decreased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
whole organism tsc22d3 expression decreased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b control Figure 4 with image from Galuh et al., 2025
whole organism pck1 expression decreased amount, abnormal AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b control Figure 4 with image from Galuh et al., 2025
whole organism pck1 expression amount, ameliorated AB/TL + CRISPR20-zbtb16a + CRISPR2-zbtb16b chemical treatment by environment: cortisol Figure 4 with image from Galuh et al., 2025
caudal fin neutrophil migration process quality, ameliorated i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) chemical treatment by environment: cortisol, amputation: caudal fin Figure 5 with image from Galuh et al., 2025
whole organism cxcl8a expression increased amount, abnormal i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) amputation: caudal fin Figure 5 with image from Galuh et al., 2025
whole organism cxcl18b expression increased amount, abnormal i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) amputation: caudal fin Figure 5 with image from Galuh et al., 2025
whole organism cxcl18b expression increased amount, abnormal i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) chemical treatment by environment: cortisol, amputation: caudal fin Figure 5 with image from Galuh et al., 2025
whole organism cxcl8a expression increased amount, abnormal i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) chemical treatment by environment: cortisol, amputation: caudal fin Figure 5 with image from Galuh et al., 2025
caudal fin neutrophil migration decreased process quality, abnormal i114Tg; ump2Tg + CRISPR20-zbtb16a + CRISPR2-zbtb16b (AB/TL) amputation: caudal fin Figure 5 with image from Galuh et al., 2025
Citations