CRISPR

CRISPR1-bcas3

ID
ZDB-CRISPR-250821-3
Name
CRISPR1-bcas3
Previous Names
None
Target
Sequence
5' - GGTCACAACCTTGCCCACCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu305 bcas3
Expression
Gene expression in Wild Types + CRISPR1-bcas3
No data available
Phenotype
Phenotype resulting from CRISPR1-bcas3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-bcas3
Phenotype Fish Conditions Figures
whole organism Ab5-bax labeling increased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
whole organism cyfip2 expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
eye decreased distance eye, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 2 with image from Liu et al., 2025
locomotion increased process quality, abnormal bcas3hzu305/hzu305 (AB) control Fig. 3 with image from Liu et al., 2025
swimming behavior increased process quality, abnormal bcas3hzu305/hzu305 (AB) altered light dark cycle Fig. 3 with image from Liu et al., 2025
exploration behavior decreased process quality, abnormal bcas3hzu305/hzu305 (AB) control Fig. 4 with image from Liu et al., 2025
brain decreased weight, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 2 with image from Liu et al., 2025
whole organism prkg1b expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
whole organism eya4 expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
whole organism decreased length, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 2 with image from Liu et al., 2025
swimming behavior increased process quality, abnormal bcas3hzu305/hzu305 (AB) control Fig. 3 with image from Liu et al., 2025
whole organism erbb3b expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain apoptotic process increased process quality, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
social behavior decreased process quality, abnormal bcas3hzu305/hzu305 (AB) control Fig. 4 with image from Liu et al., 2025
brain decreased size, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 2 with image from Liu et al., 2025
whole organism embryo development delayed, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 2 with image from Liu et al., 2025
whole organism rpl10a expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
brain bcas3 expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 1 with image from Liu et al., 2025
aggressive behavior increased process quality, abnormal bcas3hzu305/hzu305 (AB) control Fig. 4 with image from Liu et al., 2025
whole organism bcas3 expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 1 with image from Liu et al., 2025
whole organism nr2f1b expression decreased amount, abnormal bcas3hzu305/hzu305 (AB) standard conditions Fig. 6 with image from Liu et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.