CRISPR

CRISPR3-tekt3

ID
ZDB-CRISPR-250731-1
Name
CRISPR3-tekt3
Previous Names
None
Target
Sequence
5' - TTTGCAGGGCTGATAGGGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4304 tekt3
zf4305 tekt3
Expression
Gene expression in Wild Types + CRISPR3-tekt3
No data available
Phenotype
Phenotype resulting from CRISPR3-tekt3
No data available
Phenotype of all Fish created by or utilizing CRISPR3-tekt3
Phenotype Fish Conditions Figures
whole organism tekt3 expression decreased amount, abnormal tekt3zf4305/zf4305 standard conditions Figure 5 with image from Su et al., 2025
whole organism tekt1 expression increased amount, abnormal tekt3zf4305/zf4305 standard conditions Figure 5 with image from Su et al., 2025
neuromast hair cell decreased functionality, abnormal tekt3zf4305/zf4305 control Figure 6 with image from Su et al., 2025
whole organism tekt3 expression decreased amount, abnormal tekt3zf4305/+ standard conditions Figure 5 with image from Su et al., 2025
whole organism tekt1 expression increased amount, abnormal tekt3zf4305/+ standard conditions Figure 5 with image from Su et al., 2025
neuromast hair cell decreased functionality, abnormal tekt3zf4305/+ control Figure 6 with image from Su et al., 2025
startle response decreased process quality, abnormal tekt3zf4305/+ control Figure 7 with image from Su et al., 2025
neuromast cell population proliferation decreased process quality, abnormal tekt3zf4305/+; s356tTg chemical treatment by environment: neomycin Figure 8 with image from Su et al., 2025
utricle hair cell Ab1-tekt3 labeling decreased amount, abnormal tekt3zf4305/+; s356tTg standard conditions Figure 4 with image from Su et al., 2025
neuromast Ab1-tekt3 labeling decreased amount, abnormal tekt3zf4305/+; s356tTg standard conditions Figure 5 with image from Su et al., 2025
utricle hair cell morphology, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 4 with image from Su et al., 2025
utricle hair cell Ab1-tekt3 labeling decreased amount, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 4 with image from Su et al., 2025
neuromast hair cell kinocilium morphology, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 5 with image from Su et al., 2025
neuromast hair cell stereocilium maintenance decreased process quality, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 5 with image from Su et al., 2025
neuromast cell population proliferation decreased process quality, abnormal tekt3zf4305/zf4305; s356tTg chemical treatment by environment: neomycin Figure 8 with image from Su et al., 2025
neuromast regeneration delayed, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 8 with image from Su et al., 2025
neuromast Ab1-tekt3 labeling decreased amount, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 5 with image from Su et al., 2025
neuromast hair cell kinocilium curved, abnormal tekt3zf4305/zf4305; s356tTg standard conditions Figure 5 with image from Su et al., 2025
Citations